ID: 916632216

View in Genome Browser
Species Human (GRCh38)
Location 1:166628590-166628612
Sequence TTTTGAAGACAGCACTGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 250}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916632214_916632216 11 Left 916632214 1:166628556-166628578 CCAGCGTGAAGGAGTTCACAGAA 0: 1
1: 0
2: 7
3: 13
4: 76
Right 916632216 1:166628590-166628612 TTTTGAAGACAGCACTGTAGAGG 0: 1
1: 0
2: 2
3: 14
4: 250
916632211_916632216 22 Left 916632211 1:166628545-166628567 CCAAGTAAAGCCCAGCGTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 916632216 1:166628590-166628612 TTTTGAAGACAGCACTGTAGAGG 0: 1
1: 0
2: 2
3: 14
4: 250
916632213_916632216 12 Left 916632213 1:166628555-166628577 CCCAGCGTGAAGGAGTTCACAGA 0: 1
1: 0
2: 2
3: 10
4: 106
Right 916632216 1:166628590-166628612 TTTTGAAGACAGCACTGTAGAGG 0: 1
1: 0
2: 2
3: 14
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916632216 Original CRISPR TTTTGAAGACAGCACTGTAG AGG Intergenic
903482204 1:23661915-23661937 TTTTGAAGACTGCACAGTCCTGG - Intergenic
906254379 1:44336451-44336473 TGTTGATCACAGCATTGTAGAGG + Intronic
908218880 1:61983469-61983491 TTTTGAATACAGCTCTAAAGAGG + Intronic
909092960 1:71249826-71249848 TATTGAAGACATTAGTGTAGAGG - Intergenic
910718534 1:90258770-90258792 TTTTGAAGACTGCAATCCAGAGG - Intergenic
916001077 1:160616366-160616388 TTTTTAAGAAGGCACTGCAGTGG - Intronic
916021922 1:160800039-160800061 TTTTGAAGTCACCACTGAGGAGG + Exonic
916483867 1:165240221-165240243 TTTTGAAAACATGACTCTAGAGG + Intronic
916632216 1:166628590-166628612 TTTTGAAGACAGCACTGTAGAGG + Intergenic
918300796 1:183201934-183201956 TTTTGACTCCAGCACTCTAGAGG + Intronic
918453557 1:184684549-184684571 TTGTGAAGCCAGCACTTTATTGG + Intergenic
918582814 1:186151694-186151716 TTTTGAAGACTGCATTGGTGAGG - Exonic
920995771 1:210989483-210989505 CCTTGAAGACAGCACTGTTGTGG - Intronic
922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG + Intronic
922488994 1:225999999-226000021 TTTTGAAAACAGAGCTGAAGTGG - Intergenic
923195239 1:231660384-231660406 TCTTGAAGACAGCACACCAGTGG + Intronic
924059490 1:240157142-240157164 CTATTAACACAGCACTGTAGAGG - Intronic
1062982761 10:1739028-1739050 TGTTGAAGCCAGCCCTGAAGAGG - Intergenic
1063264786 10:4435738-4435760 TTCTGAAGACTGCACTTTAAGGG + Intergenic
1063573898 10:7243584-7243606 TTTTTAAGGCACCACTGTACTGG + Exonic
1065506762 10:26437682-26437704 CTTTGAAGACACAGCTGTAGAGG + Intergenic
1069360373 10:67634554-67634576 ACTTGAAGACAGCACTGTGATGG - Intronic
1069417620 10:68214845-68214867 TTCTGTACAAAGCACTGTAGAGG - Intergenic
1069844052 10:71358460-71358482 TTCTGATGACAGCCCTGAAGGGG - Intronic
1070686797 10:78490885-78490907 TCTTGAGGAGAGGACTGTAGTGG + Intergenic
1075224767 10:120618344-120618366 TTTTTAAGGAAACACTGTAGGGG + Intergenic
1080332496 11:31155369-31155391 TCTTTAAGAAAGTACTGTAGGGG + Intronic
1084339206 11:68482582-68482604 TTTTGAAGTCTTGACTGTAGAGG + Intronic
1084537759 11:69767762-69767784 TTCTGAAGACAGCCCATTAGGGG + Intergenic
1085058771 11:73425444-73425466 TTTTACAGACAGCTCTTTAGAGG - Intronic
1085908605 11:80794708-80794730 TTGTTAAGAGTGCACTGTAGAGG + Intergenic
1087110983 11:94466903-94466925 TTTTGAAGTCATCACTCTATTGG + Intronic
1088022993 11:105142330-105142352 TTTTGAAGTCAGCAATAGAGTGG - Intergenic
1094200475 12:27790136-27790158 TTTTGAAGACATCATTGTGTTGG + Intronic
1094557924 12:31521470-31521492 TTTTGTAGACTGAACTGTACAGG + Intronic
1095249271 12:39959540-39959562 TTTTGAAAACAGTATTTTAGTGG - Intronic
1095325288 12:40883630-40883652 GATGGAAGACAGCTCTGTAGGGG - Intronic
1096050474 12:48603030-48603052 TTCTGAAAACACAACTGTAGAGG + Intergenic
1096960043 12:55568636-55568658 TTGTGATGACAGCACTGAGGGGG - Intergenic
1098810989 12:75091750-75091772 TTTTTAACATAGCACTGTATAGG - Intronic
1098939030 12:76513844-76513866 TTTTGAAGACAGCATAGCACTGG + Intronic
1099845228 12:88020267-88020289 TCTTGAAGACAGCATGTTAGTGG - Intronic
1101249528 12:102918112-102918134 TTTTGAAGAAAGTAAAGTAGGGG + Intronic
1101693948 12:107107019-107107041 TGATGAAAACAGCAATGTAGAGG - Intergenic
1104170369 12:126274766-126274788 GTTTGAACACAACACTGAAGTGG - Intergenic
1109742346 13:66570731-66570753 TTTTGAATACAGGATTGTAGAGG + Intronic
1110453935 13:75668904-75668926 TTTTGAAGTAAGAATTGTAGAGG + Intronic
1110922626 13:81107897-81107919 TTTGGATGGCAGCACTCTAGTGG + Intergenic
1111388033 13:87554859-87554881 TATTCAAGACATCACAGTAGGGG - Intergenic
1113138389 13:107118705-107118727 TATTGTAAACAGCACTCTAGGGG + Intergenic
1113291906 13:108916396-108916418 TTTTGTAGGCAGCATTGTTGTGG - Intronic
1113784207 13:112993970-112993992 TTTTAAAGACAGCAGAGGAGGGG + Intronic
1115876540 14:37867861-37867883 TTTGGAAGACATCAGGGTAGAGG + Intronic
1117030026 14:51659057-51659079 TATTGAAGACAGCATAGAAGAGG + Intronic
1117517500 14:56516546-56516568 TTTTGAAGAGTCCACTGTTGGGG + Intronic
1117629785 14:57678597-57678619 TCCTGAATACAGCACAGTAGTGG - Intronic
1117786613 14:59292294-59292316 TTTTCAAGACACCACTGTCAGGG + Intronic
1118013812 14:61637939-61637961 TTTTGTACACAGCAGTTTAGTGG - Intronic
1119056847 14:71431277-71431299 TGTGGAAGAAAGCACAGTAGGGG - Intronic
1120053207 14:79892403-79892425 TTTTGGAGAAAGCATTTTAGAGG + Intergenic
1120939332 14:89931959-89931981 TTTTGAAGACTGCATTGTTTTGG - Intronic
1122603595 14:102933227-102933249 TTTTGAAGACAGGAAAGTGGAGG - Exonic
1125562880 15:40651677-40651699 TTTTTGAAACAGCACTGTATAGG - Intronic
1125565072 15:40671085-40671107 TATTGAAAACAGCATGGTAGTGG - Intergenic
1126608039 15:50500789-50500811 TCTTGCAGAAAGCAGTGTAGTGG + Exonic
1131390203 15:92041723-92041745 TTTAGAAATCAGAACTGTAGAGG + Intronic
1132165398 15:99582611-99582633 TTTGTAAGACAGCAATGTAAAGG - Intronic
1134311773 16:13081674-13081696 TTCTCAACACAGCACTTTAGAGG + Intronic
1135714972 16:24755730-24755752 TACTGAAGACAGCAGTGCAGTGG - Intronic
1136025220 16:27464425-27464447 TCTTGAAGACACCGCTGCAGCGG - Exonic
1138115884 16:54360051-54360073 TTTTAAAGTCATCACTGGAGGGG + Intergenic
1138838808 16:60472685-60472707 TTTTGAAGACAACTCTTTTGGGG - Intergenic
1139345656 16:66301782-66301804 TTTTGAAGACAGAAAAGGAGAGG + Intergenic
1139573435 16:67827240-67827262 TCTTGAGGACAGTGCTGTAGGGG - Exonic
1143158727 17:4855173-4855195 TTTTTAAGACAGGAGTGTGGTGG - Intronic
1143462554 17:7113117-7113139 TTTTAGAGACAGGAGTGTAGTGG - Intronic
1143943939 17:10572818-10572840 TTTTTATGAATGCACTGTAGGGG - Intergenic
1144969555 17:19099128-19099150 TTTTGAAGGCAACACTGCTGTGG + Intergenic
1144978361 17:19152936-19152958 TTTTGAAGGCAACACTGCTGTGG - Intronic
1144989860 17:19225297-19225319 TTTTGAAGGCAACACTGCTGTGG + Intronic
1146637148 17:34514857-34514879 TTTTGGAGACAGCACCAGAGTGG - Intergenic
1147716367 17:42511496-42511518 TTTTCAAGACAGGAGTGCAGTGG - Intronic
1148439376 17:47703660-47703682 TTTTGGAGACAGCAGCCTAGTGG - Intronic
1148918584 17:51006848-51006870 TATGGAAGACAGCTCTGAAGAGG + Intronic
1149387574 17:56157083-56157105 TTTTGAGGAGAGCACTGTACTGG + Intronic
1149657107 17:58316008-58316030 TTTTGAAGGTAGGAATGTAGTGG - Exonic
1150575636 17:66428303-66428325 TTTTGAAGACAGCTCGATATCGG - Intronic
1151652748 17:75480319-75480341 GATTAAAGACAGCACAGTAGAGG - Intronic
1153489492 18:5632117-5632139 TCCTGAAGACAGCAGTCTAGTGG + Intergenic
1155118894 18:22798322-22798344 TTTTGAAGAGAGCAATTCAGAGG + Intronic
1155261543 18:24047817-24047839 TATTGAAGACAGTTCCGTAGAGG + Intronic
1155272987 18:24158772-24158794 TCTTGAAGACAGTACTGTCTTGG - Intronic
1156416733 18:36901922-36901944 TTTTGAAGAAACTACTATAGAGG + Intronic
1157938870 18:51903864-51903886 TTTTAAAGACAGCTCAGTGGTGG - Intergenic
1158765411 18:60445243-60445265 TTCTGAAGACAGCATTCTAATGG + Intergenic
1161578352 19:5067122-5067144 GGCTGAAGACAGCACTGTTGAGG - Intronic
924985908 2:269760-269782 TCTTGAAGACAGCATTTCAGAGG + Intronic
925217897 2:2112923-2112945 TTATGAAGCCAGCTCTGCAGAGG - Intronic
925397057 2:3541839-3541861 TTTTTAAAACAGCTCTGTTGAGG - Intronic
925455464 2:4012892-4012914 TTTTGAGGACAGCACAGAGGGGG + Intergenic
934584533 2:95479136-95479158 TTTTGAAGAGTGCAATGCAGAGG - Intergenic
934594919 2:95597579-95597601 TTTTGAAGAGTGCAATGCAGAGG + Intronic
934743824 2:96745303-96745325 TTTGGAAGACAGGAAGGTAGAGG - Intergenic
934787846 2:97027937-97027959 TTTTGAAGAGTGCAATGCAGAGG - Intergenic
936673979 2:114692991-114693013 TTTTGAAGACAGCATAGTGATGG + Intronic
938659680 2:133472853-133472875 TTTCTAAGGCAGCACTGCAGAGG - Intronic
938890765 2:135702949-135702971 TGTTAGAGACAGCACTTTAGTGG - Intronic
940701179 2:157044899-157044921 TTTTCAAGACAGTTGTGTAGAGG + Intergenic
941173360 2:162166402-162166424 TTTTAGGGGCAGCACTGTAGTGG - Intergenic
941531840 2:166679915-166679937 TATTGAAAACAGCATTTTAGAGG + Intergenic
941735388 2:168969455-168969477 TTTTGAACATGGCACTGCAGTGG - Exonic
943642708 2:190376491-190376513 TTTTGAAGCCAACATTCTAGAGG - Intergenic
944634489 2:201661554-201661576 TTTTGAGAACAGCACTGCAGAGG - Intronic
944887556 2:204079510-204079532 TTTTCAAGGCAGCACTGAATAGG - Intergenic
946747966 2:222864317-222864339 TTTTGAAGACCTCCATGTAGAGG + Intronic
947817094 2:233044908-233044930 TTTGGAGGACATCACTGTACGGG - Intergenic
948727290 2:239942807-239942829 GTTTTAACACAGCACTGGAGGGG + Intronic
948952260 2:241261574-241261596 TTTTGTAATCAACACTGTAGGGG - Intronic
1170004305 20:11648372-11648394 TTTAGAAGAGAGTACTGAAGTGG + Intergenic
1170062761 20:12276521-12276543 ACTTGAAGCCAGCACAGTAGTGG - Intergenic
1170361043 20:15546705-15546727 TTTTGATGCCAGCTCTTTAGAGG + Intronic
1172688942 20:36777608-36777630 TTTTGAAGACAGAAGTGGAAAGG + Exonic
1173369341 20:42420819-42420841 TGTTGCAGAGAACACTGTAGTGG + Intronic
1175355637 20:58365173-58365195 TTTTGAATGCAGTACTGTGGAGG + Exonic
1175619569 20:60431886-60431908 TTTTGAAGACAGTACACCAGTGG + Intergenic
1176611653 21:8989558-8989580 TTTTGGAGACCTCACTCTAGAGG + Intergenic
1177105012 21:16944980-16945002 TTTGGAAGACACCATTGTTGAGG - Intergenic
1178857148 21:36259678-36259700 TCCTGAAGACAGCTCTGCAGAGG + Intronic
1178944276 21:36933263-36933285 GTTTGTAGACAGCCCTGGAGAGG + Intronic
1179792841 21:43765412-43765434 TTATAAAGGCAGCACTGTTGAGG + Intergenic
1181343967 22:22203624-22203646 TCTTGCTGACAGCACCGTAGAGG - Intergenic
1182619000 22:31608069-31608091 ATGTGAAGACAGCGCTGTTGTGG + Intronic
1184576772 22:45374968-45374990 TTTTGGAGAAAGCATTTTAGAGG - Intronic
949685770 3:6568175-6568197 TTTTGAAGAAAGAAGAGTAGAGG - Intergenic
950243377 3:11392304-11392326 TTTTCAAAACAGCACTGTCTTGG - Intronic
950384331 3:12645608-12645630 TTTGGAATACAGTAATGTAGTGG + Intronic
950859867 3:16138267-16138289 TCTTGAAGACAGACCTGGAGAGG - Intergenic
951034885 3:17921868-17921890 TTTTGAAGGCAGAACTTTGGGGG + Intronic
951372845 3:21872779-21872801 TTATCAAAACAGCATTGTAGCGG - Intronic
951528514 3:23677152-23677174 GTTTGAAGACAGGAGTGCAGTGG + Intergenic
953019440 3:39104330-39104352 TTTTGGAGACAGCAGTGAGGTGG - Intronic
956911854 3:73826412-73826434 TTTTGAACTCCCCACTGTAGTGG + Intergenic
956968058 3:74487136-74487158 TTTTGTAAATAGCACTGTAATGG - Intronic
957540856 3:81567035-81567057 TTTTGCAGACAGCTCTTTTGAGG - Intronic
957824267 3:85420147-85420169 TTTAGAAGAAAGCAGTGAAGGGG + Intronic
957854178 3:85852206-85852228 TTTCCAAGAAAGCAGTGTAGAGG - Intronic
958076067 3:88680022-88680044 TCTTGAAAATAGCTCTGTAGAGG - Intergenic
958670558 3:97198287-97198309 ATTTGAAAACATCACTGAAGTGG + Intronic
959106251 3:102068195-102068217 TTTTGAAGTCAGTAGTGTACTGG - Intergenic
959736402 3:109664599-109664621 TTTTGAAGATTTCACTGAAGAGG - Intergenic
961150439 3:124633053-124633075 TTTTGAAAACAGGACTGTGCTGG + Intronic
963125880 3:141815764-141815786 GTTTCAAGACAGCCCTGTGGAGG + Intronic
964237651 3:154552023-154552045 TGTTGAACTCAGCCCTGTAGAGG - Intergenic
964237694 3:154552577-154552599 TTTTGAACTCAGCCCTGTAGAGG - Intergenic
964346548 3:155759737-155759759 TTTTAAAGACAAGATTGTAGGGG + Intergenic
964865560 3:161255934-161255956 TGTTGGAGTCAGCACTGCAGTGG + Intergenic
965343081 3:167513688-167513710 TTTTGAAGACAGCACACCAATGG - Intronic
966762781 3:183432019-183432041 TTTTGCAGATACCACTGTAAAGG + Intergenic
967349515 3:188496816-188496838 ATTGGAAGAAAGCACTGTGGTGG + Intronic
967396356 3:189013916-189013938 TCTTGAAGATAGCATTGCAGTGG + Intronic
968639129 4:1701972-1701994 TTTGGAAAACAGCACTGTTTGGG - Intronic
968824185 4:2880976-2880998 TTTTGAAGAAAGTACTGCAAAGG + Intronic
969445189 4:7240779-7240801 TTTTGGAGACAGCACCACAGCGG - Intronic
970104366 4:12564077-12564099 GTTTGAAGATAGAACTGCAGAGG - Intergenic
971610531 4:28719692-28719714 TTTTGAAGATCGCAGTGCAGTGG + Intergenic
978497396 4:109375084-109375106 TCTTGAAGACAGAACTGTCTAGG - Intergenic
980204642 4:129701951-129701973 TTTTGAAGATAGTACTTTATAGG - Intergenic
980640112 4:135566132-135566154 TTTTGTAGAGAACACTGTGGTGG + Intergenic
981221026 4:142235111-142235133 CTTTGAAGATAGCACTGTGAAGG + Intronic
981351598 4:143736271-143736293 TTTTGTATACAACACTGTGGGGG + Intergenic
982283704 4:153712868-153712890 TATGGAAGACATCACTGTAAAGG - Intronic
982605454 4:157510994-157511016 TTTTTAAGACACCAGTCTAGGGG + Intergenic
983193193 4:164776390-164776412 TTTGCAAGAAGGCACTGTAGAGG + Intergenic
983207022 4:164921075-164921097 TTTTGCAGCCATCACTGAAGTGG - Intergenic
983476840 4:168222382-168222404 TTTTGCAAACTGTACTGTAGAGG + Intronic
984251946 4:177346204-177346226 TTTTAAAGACAGGAGTGCAGTGG + Intronic
986325286 5:6668637-6668659 CCTTGAAGAGATCACTGTAGGGG - Exonic
987521349 5:18988046-18988068 TTTTTAAGTTATCACTGTAGAGG - Intergenic
987616203 5:20277202-20277224 TCTTGAAGACAGCACAGTTCTGG - Intronic
988387395 5:30582884-30582906 CTTTGAAGAGAGCACCATAGAGG - Intergenic
989176064 5:38527747-38527769 TTTTGAAAACAGAACTGAAGAGG - Intronic
989290338 5:39757484-39757506 TTGTGAAGAAAGCACTGTAGAGG + Intergenic
990626162 5:57613662-57613684 TTTTCAAAAGAGCACTGAAGAGG + Intergenic
990780906 5:59361978-59362000 TTTTCAGGGCAGCACTGTATAGG + Intronic
991358685 5:65797083-65797105 TTTTGAAGATAGCAATCAAGAGG + Intronic
993084020 5:83340584-83340606 TTTTGAAGACAGGAAGGGAGTGG + Intronic
993729201 5:91402457-91402479 GTTTGAAGACAGCACTGCACTGG - Intergenic
993818840 5:92588743-92588765 TTTGGAAGAAAGCACTATAAAGG - Intergenic
994157145 5:96516276-96516298 TTTTGAACAGAGCAATGTATTGG - Intergenic
994357304 5:98808073-98808095 TTTTTATGACAGCACTGTGCTGG - Intergenic
994434139 5:99706916-99706938 TTTTGAAGAAAGAACATTAGGGG - Intergenic
995578814 5:113572870-113572892 TTTTGAAGACAGCATACTCGTGG + Intronic
996835930 5:127792385-127792407 TCATGAAAACAGCAGTGTAGGGG + Intergenic
998578724 5:143346990-143347012 TTTAGTACACAGCACTGTAAAGG + Intronic
999038619 5:148382595-148382617 TTTTGTAAAAAGCACTGTAGTGG - Intergenic
1001435777 5:171698236-171698258 TTTTGAAGGGTGCACTGGAGAGG + Intergenic
1003238337 6:4318621-4318643 TATTGAAGTCAGCACTGTCTGGG + Intergenic
1003477730 6:6499616-6499638 TTTTAAAAACAGCACTGTGGAGG + Intergenic
1003551453 6:7105940-7105962 TTTTGAAGACAGGCCAGTCGTGG - Intergenic
1005160834 6:22861469-22861491 ATTTGAACCAAGCACTGTAGTGG + Intergenic
1006554133 6:34851573-34851595 ATGTGAAGCCAGCACTGTACTGG + Intronic
1009703877 6:67219883-67219905 TTTTGCAGACAGGCCTGTACTGG + Intergenic
1011272906 6:85597620-85597642 TTTTGAAGAAAGCAGTTCAGTGG - Intronic
1011426532 6:87238001-87238023 TTTTCAAGACAGCCATCTAGTGG + Intronic
1012240323 6:96863848-96863870 TTTTGCAGACAGTAGTGTACTGG - Intergenic
1012902845 6:105027799-105027821 TTTTGAAGAAAGAACTGTAAAGG + Intronic
1013006282 6:106077194-106077216 CTGTGAAGGGAGCACTGTAGTGG - Intergenic
1013511590 6:110849493-110849515 TTTTGAATCCAGCTCTTTAGAGG + Intronic
1015233712 6:130946498-130946520 TTTTAAAAACAGTACTGTATTGG + Intronic
1015250684 6:131124549-131124571 TTGTGAAGACAGGACTGTGCAGG - Intergenic
1016002879 6:139060273-139060295 TCTTGAGGACAGCACTGAATAGG - Intergenic
1016376600 6:143427490-143427512 TTTTGAACACAACACTGGAAAGG - Exonic
1017930473 6:158949641-158949663 TTTTTAAAAAATCACTGTAGGGG - Intergenic
1018074203 6:160196307-160196329 TAATGAAGACAGCACGGTACTGG + Intronic
1020588593 7:10105034-10105056 TATTGTAAACAGCACAGTAGTGG - Intergenic
1021444323 7:20716528-20716550 TTTTAAACACAGTACTTTAGTGG + Intronic
1023736195 7:43238087-43238109 CTTAGAAGACAGCTCTGTTGTGG + Intronic
1024778509 7:52817399-52817421 ATTTGAAATCAGCAATGTAGAGG + Intergenic
1026968899 7:74455946-74455968 TCTTGAAGACAGCTTTGTAGGGG + Intronic
1027821611 7:83052949-83052971 TTATTCAGACAGCAGTGTAGAGG - Intronic
1028131339 7:87177892-87177914 TTCTGAAGACAGCGCTGTACTGG - Intronic
1028505895 7:91569652-91569674 TTGTGAATAAAGCACTGTAAGGG - Intergenic
1030438414 7:109554144-109554166 TCTTGAAGACAGCACACTAATGG - Intergenic
1033517035 7:142117072-142117094 TTTTGAATACTGCAATGTAGTGG - Intronic
1037421920 8:18711366-18711388 TCTTGAAGACAGCACAGCAATGG - Intronic
1039678946 8:39707948-39707970 ATTTGAACAAAGCACTGTAACGG + Intronic
1040635476 8:49268687-49268709 TTTTGAAGACAGCAGATTATTGG + Intergenic
1041349821 8:56937270-56937292 CTTTGAAAACAGCATTGTTGGGG + Intergenic
1041562005 8:59228460-59228482 TCTTGAAGACAGCACACTATTGG - Intergenic
1041754635 8:61300418-61300440 TTTTGAAGACAGCACACCTGTGG - Intronic
1041798973 8:61777485-61777507 TTTGGAATACAGCAATGTAATGG + Intergenic
1042578440 8:70249356-70249378 TTTTGAAGAGGCCACTTTAGAGG + Intronic
1043773444 8:84234301-84234323 TTTTGTAGAAAGCTCTGTAAAGG + Intronic
1043821963 8:84877634-84877656 TTTTGATCACAGCATCGTAGAGG + Intronic
1046135039 8:110014856-110014878 TTTTGAAGACAGCATACTGGTGG + Intergenic
1046427365 8:114072486-114072508 TTTTGGAAACAGGACTGCAGAGG + Intergenic
1048037444 8:130690933-130690955 TTTTGAAGACAGCACATGATTGG + Intergenic
1050398344 9:5223982-5224004 TTTTGAAGACAGCATAGCAATGG - Intergenic
1051161287 9:14211178-14211200 TTTTGAATACAATATTGTAGAGG - Intronic
1053044674 9:34905394-34905416 TGTTGAATAAAACACTGTAGGGG + Intergenic
1055775198 9:79760329-79760351 CTTTGGGGACAACACTGTAGAGG - Intergenic
1056499329 9:87192390-87192412 TGCTGAAGACAGGAATGTAGGGG + Intergenic
1057245324 9:93450585-93450607 TTTTGGAGAAACCTCTGTAGAGG - Exonic
1057368460 9:94447005-94447027 TTTTGAGGAAACCACTGCAGAGG + Intronic
1057873349 9:98734245-98734267 TTTTGCAGACAGGACAGCAGAGG - Exonic
1058673353 9:107379621-107379643 TTTTAAAGACAGCAAATTAGAGG - Intergenic
1059529111 9:115019348-115019370 TTTTGGGGACTGCAGTGTAGAGG + Intergenic
1059953178 9:119489025-119489047 TTCTGCAGACAGTCCTGTAGGGG + Intergenic
1059970572 9:119663653-119663675 TTTCCATGACAGCACTGAAGAGG - Intergenic
1188255339 X:27955856-27955878 TTTTGGAGAAAGCATTTTAGAGG - Intergenic
1189020849 X:37337712-37337734 TTTAGAACACAGCACTTAAGTGG - Intergenic
1189314418 X:40044069-40044091 TTTTGATAAGAACACTGTAGAGG + Intergenic
1190481690 X:50883811-50883833 TTTAGAAAACAGCACTGGAGAGG - Intergenic
1192350745 X:70354665-70354687 TTTTGAAGACAGAAGTGGGGAGG + Intronic
1192556941 X:72097787-72097809 TTTTGAAAAGAGAACTATAGCGG - Intergenic
1193300089 X:79879291-79879313 ACCTGAAGACAGCACTGTACTGG - Intergenic
1194330490 X:92578661-92578683 TCTTGAATACAGCACTCTGGTGG + Intronic
1194389268 X:93295515-93295537 ATTTGAAGCCAGCACAGTACTGG - Intergenic
1194839083 X:98716047-98716069 TTTTGATGACAGCACCAAAGGGG - Intergenic
1194937532 X:99969792-99969814 TCTTGAAGCCAGCATAGTAGTGG + Intergenic
1197487602 X:127073788-127073810 GCTTGAAGCCAGCACTGTACTGG + Intergenic
1197910334 X:131476348-131476370 TTTTAAAAACAGCTCTGAAGAGG + Intergenic
1198634642 X:138682499-138682521 TTTGGAAGACTGCACTGTAGGGG - Intronic
1199085987 X:143631784-143631806 CTTTGAAGGCAGCAGTGTACAGG - Intronic
1200673762 Y:6125667-6125689 TTGTGAAGACAGCATAGTATTGG + Intergenic
1201303927 Y:12534582-12534604 TGCTGAAGTCAGCCCTGTAGAGG - Intergenic
1201980279 Y:19899677-19899699 CTTTGAAGCCAGCACAGCAGTGG - Intergenic