ID: 916634270

View in Genome Browser
Species Human (GRCh38)
Location 1:166651534-166651556
Sequence GGGGATTCTCCTACAAATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916634270_916634271 -7 Left 916634270 1:166651534-166651556 CCACTATTTGTAGGAGAATCCCC No data
Right 916634271 1:166651550-166651572 AATCCCCAACCTCCTTAGTATGG No data
916634270_916634277 16 Left 916634270 1:166651534-166651556 CCACTATTTGTAGGAGAATCCCC No data
Right 916634277 1:166651573-166651595 TACATCCCACTCTCCAGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916634270 Original CRISPR GGGGATTCTCCTACAAATAG TGG (reversed) Intergenic
No off target data available for this crispr