ID: 916635285

View in Genome Browser
Species Human (GRCh38)
Location 1:166661725-166661747
Sequence GTGGCCAACCACACTGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916635285_916635294 18 Left 916635285 1:166661725-166661747 CCACCCTCAGTGTGGTTGGCCAC No data
Right 916635294 1:166661766-166661788 TCCAATAAAACAAAAGGCAGAGG No data
916635285_916635296 23 Left 916635285 1:166661725-166661747 CCACCCTCAGTGTGGTTGGCCAC No data
Right 916635296 1:166661771-166661793 TAAAACAAAAGGCAGAGGAAAGG No data
916635285_916635293 12 Left 916635285 1:166661725-166661747 CCACCCTCAGTGTGGTTGGCCAC No data
Right 916635293 1:166661760-166661782 TATAGCTCCAATAAAACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916635285 Original CRISPR GTGGCCAACCACACTGAGGG TGG (reversed) Intergenic
No off target data available for this crispr