ID: 916639900

View in Genome Browser
Species Human (GRCh38)
Location 1:166716598-166716620
Sequence AGACCCTGCCTCAAAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916639898_916639900 -7 Left 916639898 1:166716582-166716604 CCAGCCTGGGCAACAGAGACCCT 0: 140
1: 573
2: 1676
3: 3997
4: 14283
Right 916639900 1:166716598-166716620 AGACCCTGCCTCAAAAAGAAAGG No data
916639897_916639900 3 Left 916639897 1:166716572-166716594 CCACTGCACTCCAGCCTGGGCAA 0: 66497
1: 175004
2: 225621
3: 191618
4: 110379
Right 916639900 1:166716598-166716620 AGACCCTGCCTCAAAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916639900 Original CRISPR AGACCCTGCCTCAAAAAGAA AGG Intergenic
No off target data available for this crispr