ID: 916640103

View in Genome Browser
Species Human (GRCh38)
Location 1:166718137-166718159
Sequence TGCCCTCAGCAGAGGTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916640092_916640103 17 Left 916640092 1:166718097-166718119 CCCTGGGGCATCCTCCAGACCTC No data
Right 916640103 1:166718137-166718159 TGCCCTCAGCAGAGGTTCTGTGG No data
916640100_916640103 -8 Left 916640100 1:166718122-166718144 CCTTTCCAAAGGGGATGCCCTCA No data
Right 916640103 1:166718137-166718159 TGCCCTCAGCAGAGGTTCTGTGG No data
916640099_916640103 -2 Left 916640099 1:166718116-166718138 CCTCAACCTTTCCAAAGGGGATG No data
Right 916640103 1:166718137-166718159 TGCCCTCAGCAGAGGTTCTGTGG No data
916640091_916640103 30 Left 916640091 1:166718084-166718106 CCAAAGGGGGATACCCTGGGGCA No data
Right 916640103 1:166718137-166718159 TGCCCTCAGCAGAGGTTCTGTGG No data
916640094_916640103 6 Left 916640094 1:166718108-166718130 CCTCCAGACCTCAACCTTTCCAA No data
Right 916640103 1:166718137-166718159 TGCCCTCAGCAGAGGTTCTGTGG No data
916640093_916640103 16 Left 916640093 1:166718098-166718120 CCTGGGGCATCCTCCAGACCTCA No data
Right 916640103 1:166718137-166718159 TGCCCTCAGCAGAGGTTCTGTGG No data
916640095_916640103 3 Left 916640095 1:166718111-166718133 CCAGACCTCAACCTTTCCAAAGG No data
Right 916640103 1:166718137-166718159 TGCCCTCAGCAGAGGTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916640103 Original CRISPR TGCCCTCAGCAGAGGTTCTG TGG Intergenic
No off target data available for this crispr