ID: 916640556

View in Genome Browser
Species Human (GRCh38)
Location 1:166724402-166724424
Sequence ATGCCCTTCTACAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916640556_916640559 7 Left 916640556 1:166724402-166724424 CCTTCACTCTTGTAGAAGGGCAT No data
Right 916640559 1:166724432-166724454 TAGGACCTTTTTCCATGGTTTGG No data
916640556_916640558 2 Left 916640556 1:166724402-166724424 CCTTCACTCTTGTAGAAGGGCAT No data
Right 916640558 1:166724427-166724449 TTTGTTAGGACCTTTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916640556 Original CRISPR ATGCCCTTCTACAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr