ID: 916647134

View in Genome Browser
Species Human (GRCh38)
Location 1:166797273-166797295
Sequence CTCGGTTGGCAGCACTGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916647134_916647139 -2 Left 916647134 1:166797273-166797295 CCTGTTCAGTGCTGCCAACCGAG No data
Right 916647139 1:166797294-166797316 AGGGTCTGTGAGTAGCTGCGTGG No data
916647134_916647143 13 Left 916647134 1:166797273-166797295 CCTGTTCAGTGCTGCCAACCGAG No data
Right 916647143 1:166797309-166797331 CTGCGTGGGGTCAAGCAGCAGGG No data
916647134_916647140 -1 Left 916647134 1:166797273-166797295 CCTGTTCAGTGCTGCCAACCGAG No data
Right 916647140 1:166797295-166797317 GGGTCTGTGAGTAGCTGCGTGGG No data
916647134_916647142 12 Left 916647134 1:166797273-166797295 CCTGTTCAGTGCTGCCAACCGAG No data
Right 916647142 1:166797308-166797330 GCTGCGTGGGGTCAAGCAGCAGG No data
916647134_916647141 0 Left 916647134 1:166797273-166797295 CCTGTTCAGTGCTGCCAACCGAG No data
Right 916647141 1:166797296-166797318 GGTCTGTGAGTAGCTGCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916647134 Original CRISPR CTCGGTTGGCAGCACTGAAC AGG (reversed) Intergenic
No off target data available for this crispr