ID: 916647140

View in Genome Browser
Species Human (GRCh38)
Location 1:166797295-166797317
Sequence GGGTCTGTGAGTAGCTGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916647134_916647140 -1 Left 916647134 1:166797273-166797295 CCTGTTCAGTGCTGCCAACCGAG No data
Right 916647140 1:166797295-166797317 GGGTCTGTGAGTAGCTGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916647140 Original CRISPR GGGTCTGTGAGTAGCTGCGT GGG Intergenic
No off target data available for this crispr