ID: 916647142

View in Genome Browser
Species Human (GRCh38)
Location 1:166797308-166797330
Sequence GCTGCGTGGGGTCAAGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916647138_916647142 -6 Left 916647138 1:166797291-166797313 CCGAGGGTCTGTGAGTAGCTGCG No data
Right 916647142 1:166797308-166797330 GCTGCGTGGGGTCAAGCAGCAGG No data
916647134_916647142 12 Left 916647134 1:166797273-166797295 CCTGTTCAGTGCTGCCAACCGAG No data
Right 916647142 1:166797308-166797330 GCTGCGTGGGGTCAAGCAGCAGG No data
916647137_916647142 -2 Left 916647137 1:166797287-166797309 CCAACCGAGGGTCTGTGAGTAGC No data
Right 916647142 1:166797308-166797330 GCTGCGTGGGGTCAAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916647142 Original CRISPR GCTGCGTGGGGTCAAGCAGC AGG Intergenic
No off target data available for this crispr