ID: 916647143

View in Genome Browser
Species Human (GRCh38)
Location 1:166797309-166797331
Sequence CTGCGTGGGGTCAAGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916647138_916647143 -5 Left 916647138 1:166797291-166797313 CCGAGGGTCTGTGAGTAGCTGCG No data
Right 916647143 1:166797309-166797331 CTGCGTGGGGTCAAGCAGCAGGG No data
916647137_916647143 -1 Left 916647137 1:166797287-166797309 CCAACCGAGGGTCTGTGAGTAGC No data
Right 916647143 1:166797309-166797331 CTGCGTGGGGTCAAGCAGCAGGG No data
916647134_916647143 13 Left 916647134 1:166797273-166797295 CCTGTTCAGTGCTGCCAACCGAG No data
Right 916647143 1:166797309-166797331 CTGCGTGGGGTCAAGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916647143 Original CRISPR CTGCGTGGGGTCAAGCAGCA GGG Intergenic
No off target data available for this crispr