ID: 916651678

View in Genome Browser
Species Human (GRCh38)
Location 1:166839645-166839667
Sequence CCCAGCCGCCCGGGACCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 473}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916651678_916651688 -7 Left 916651678 1:166839645-166839667 CCCCCGGGTCCCGGGCGGCTGGG 0: 1
1: 0
2: 1
3: 29
4: 473
Right 916651688 1:166839661-166839683 GGCTGGGCCGCGGCAGAGGCGGG 0: 1
1: 0
2: 6
3: 84
4: 749
916651678_916651692 3 Left 916651678 1:166839645-166839667 CCCCCGGGTCCCGGGCGGCTGGG 0: 1
1: 0
2: 1
3: 29
4: 473
Right 916651692 1:166839671-166839693 CGGCAGAGGCGGGGGCGCCGAGG 0: 1
1: 0
2: 5
3: 73
4: 796
916651678_916651689 -6 Left 916651678 1:166839645-166839667 CCCCCGGGTCCCGGGCGGCTGGG 0: 1
1: 0
2: 1
3: 29
4: 473
Right 916651689 1:166839662-166839684 GCTGGGCCGCGGCAGAGGCGGGG 0: 1
1: 0
2: 2
3: 41
4: 445
916651678_916651687 -8 Left 916651678 1:166839645-166839667 CCCCCGGGTCCCGGGCGGCTGGG 0: 1
1: 0
2: 1
3: 29
4: 473
Right 916651687 1:166839660-166839682 CGGCTGGGCCGCGGCAGAGGCGG 0: 1
1: 0
2: 4
3: 40
4: 386
916651678_916651690 -5 Left 916651678 1:166839645-166839667 CCCCCGGGTCCCGGGCGGCTGGG 0: 1
1: 0
2: 1
3: 29
4: 473
Right 916651690 1:166839663-166839685 CTGGGCCGCGGCAGAGGCGGGGG 0: 1
1: 0
2: 10
3: 78
4: 702

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916651678 Original CRISPR CCCAGCCGCCCGGGACCCGG GGG (reversed) Intronic
900140114 1:1136332-1136354 CCCAGCCCCCAGGCACCCAGAGG - Intergenic
900284262 1:1891499-1891521 CCCACCCGCCCCGTCCCCGGAGG - Intergenic
900427464 1:2587075-2587097 CCCAGCCGCCCGGCAGGCCGTGG + Exonic
900513017 1:3069326-3069348 CCCGGCGGCCCGGGCCCCGGCGG - Intronic
900639452 1:3681780-3681802 CCCTGATGCCCGGGACCTGGAGG - Intronic
901885232 1:12218115-12218137 CCCAGCTGCCTGGGAGCCTGAGG - Intergenic
902354566 1:15887910-15887932 CCCAGCTGCTCGGGAGGCGGAGG + Intronic
902911021 1:19597243-19597265 GCGAGCCGCCCGGGCCCCGGCGG + Intronic
903349645 1:22710346-22710368 CCCTGCCACCCGGGTCCCTGCGG - Intergenic
903652493 1:24930307-24930329 CCCCGCCCCGCGGGCCCCGGGGG - Intronic
904136890 1:28319922-28319944 CCCAGCTGCTCGGGACGCTGAGG - Intergenic
904284049 1:29442717-29442739 CCCAGCTGCCCGGGAGGCTGAGG + Intergenic
904291865 1:29491589-29491611 CCCAGCTGCTCGGGAGCCTGAGG - Intergenic
905276429 1:36821579-36821601 CCCAGCATCCTGGGACCCGGTGG - Intronic
906263160 1:44407918-44407940 CGCAGCCGCGCGGGGCCCGCGGG - Intronic
906457940 1:46013562-46013584 CCCAGCCGCTCGGGAGGCTGAGG + Intronic
906625109 1:47318716-47318738 CCCAGCTGCTCGGGAGCCTGAGG - Intergenic
907479409 1:54734500-54734522 CCCAGCTACCTGGGAACCGGAGG - Intronic
907880715 1:58546844-58546866 CCCAGCTGCCCCGGGCCCCGCGG + Intergenic
908455782 1:64303628-64303650 CCCAGCCGCTCGGGAGGCTGAGG - Intergenic
908703231 1:66924613-66924635 TCCATCCCCCTGGGACCCGGAGG - Intronic
908711754 1:67023599-67023621 CCCAGCTACCCGGGAGGCGGAGG - Intronic
910981139 1:92961228-92961250 CCCTGCCGTCCGGCACCTGGCGG - Intronic
912492225 1:110068863-110068885 CCCAGCACCCCGGGATCCGACGG - Intronic
913963123 1:143354243-143354265 CGCAGCTGCCCGGGGCCAGGCGG - Intergenic
914057479 1:144179829-144179851 CGCAGCTGCCCGGGGCCAGGCGG - Intergenic
914121667 1:144786537-144786559 CGCAGCTGCCCGGGGCCAGGCGG + Intergenic
914344056 1:146783097-146783119 CCCAGCTACCCGGGACGCTGAGG - Intergenic
914386265 1:147172612-147172634 CCTCGGCGCCCGGGACCCGCCGG + Intergenic
914428010 1:147596527-147596549 CCCAGCTACCCGGGAGCCTGAGG - Intronic
914704312 1:150158940-150158962 CCCAGCTGGCAGGGAGCCGGCGG + Exonic
915044159 1:152997850-152997872 CCCAGCCACACTGGACCCTGAGG - Intergenic
915114720 1:153589761-153589783 CCCAGCCGCTCGGGAGGCTGAGG + Intergenic
915289868 1:154876329-154876351 CCCAGCTGCCCGGGAGGCTGAGG - Intergenic
915902073 1:159854631-159854653 CCCAGCCGCCTGGCAGCCTGGGG + Exonic
916651678 1:166839645-166839667 CCCAGCCGCCCGGGACCCGGGGG - Intronic
916782976 1:168056322-168056344 CCCAGCTGCCAGGGCCTCGGCGG + Intronic
917325963 1:173832651-173832673 CCCAGCCGCTCGGGAGGCTGAGG + Intronic
917359509 1:174160031-174160053 CCCAGCCGCCCTGCGTCCGGTGG + Intronic
917797651 1:178543158-178543180 CCAAGCCACCAGGCACCCGGCGG - Intronic
919041180 1:192390641-192390663 CCCAGCTACCCGGGAGCCTGAGG - Intergenic
919903613 1:202061934-202061956 CCCAGCTACCCGGGAGGCGGAGG + Intergenic
920746363 1:208632754-208632776 CCCAGCCACCCGGGAGGCTGAGG - Intergenic
921010236 1:211133949-211133971 CCCAGCAGCTCGGGGTCCGGCGG + Exonic
921338679 1:214112477-214112499 CCCAGCCGCTCGGGAGGCTGAGG + Intergenic
923126687 1:231039995-231040017 CGCCGCCGCCCGGGCCCCCGCGG + Exonic
923171642 1:231422218-231422240 CCGGGCCGCCCGGGACGCTGAGG - Exonic
923281108 1:232443638-232443660 TCCAGCGACCCTGGACCCGGCGG - Exonic
923316270 1:232783570-232783592 CCCAGCTACTCGGGACCCTGAGG - Intergenic
923577848 1:235176712-235176734 CACAGCCGCCCGGGGCCCCAGGG + Intronic
924000801 1:239549543-239549565 CCCAGCTGCCCGGGAGGCTGAGG + Intronic
1063090576 10:2863231-2863253 CCCAGCTACTCGGGACGCGGAGG - Intergenic
1063485246 10:6414156-6414178 CCCAGCTGCCTGGGACCCTCTGG - Intergenic
1064074167 10:12255742-12255764 CCCAGCTACCTGGGACCCTGAGG + Intergenic
1064523584 10:16229588-16229610 CCCAGCCGCTCGGGAGGCTGAGG - Intergenic
1065113735 10:22464479-22464501 CCCAGCCGCTCAGGAGCCTGAGG - Intergenic
1065185430 10:23166042-23166064 CCCAGCCACCCGGGAGGCTGAGG + Intergenic
1065507066 10:26439234-26439256 CCCAGTCTCCCGGAACCTGGAGG + Intronic
1065687751 10:28302910-28302932 CCCTGCAGCCCCGGGCCCGGAGG + Intronic
1066022963 10:31320222-31320244 CCCATCCGCGCGGCTCCCGGCGG - Intronic
1066590714 10:36991072-36991094 CCCAGCCACTCGGGAGCCTGAGG + Intergenic
1067853140 10:49768375-49768397 CCCAGCCCTCAGGGCCCCGGCGG + Intergenic
1070614223 10:77956898-77956920 CCCAGCTACCCGGGATGCGGAGG + Intergenic
1071148106 10:82598932-82598954 CCCAGCTGCTCGGGAGCCTGAGG + Intronic
1072665417 10:97389207-97389229 CCCAGCTGCTCGGGAGGCGGAGG - Intronic
1076403926 10:130200334-130200356 CCCAGGGGCCCGGTACCCTGTGG + Intergenic
1076793791 10:132789308-132789330 CCCAGGAGCCCGGGCCCAGGCGG + Intergenic
1076843242 10:133056875-133056897 CCCAGCCACAGGGGACCCGGGGG + Intergenic
1077060844 11:617308-617330 CCCAGCCGCACGGGCACTGGAGG - Exonic
1077476533 11:2792948-2792970 CCCCGCCCCCCGGGAGCCGCAGG + Intronic
1077495199 11:2883938-2883960 CAAAGCCGGCGGGGACCCGGCGG + Intronic
1079464425 11:20715127-20715149 CCCAGCTACTCGGGACCCTGAGG + Intronic
1079621472 11:22560807-22560829 CCCAGCTGCCCGGGAGGCTGAGG - Intergenic
1080802078 11:35618570-35618592 CCCAGGCACCCGGGTCCCGGCGG - Exonic
1081537963 11:44009050-44009072 CCCAGCTACCCGGGACGCTGAGG + Intergenic
1083190974 11:61052369-61052391 CCCAGGCTCCAGGGATCCGGTGG - Intergenic
1083708058 11:64530209-64530231 GCCAGCAGCTCTGGACCCGGAGG + Intergenic
1083747804 11:64745088-64745110 CCCCGCCGCCCGGGACGCGGAGG + Intronic
1083922114 11:65786757-65786779 CCCAGCCGGCCCGGCCCCCGCGG - Intergenic
1084010916 11:66347805-66347827 CCCGCCCGCCCGGGCCCCGCCGG + Intergenic
1084945655 11:72636984-72637006 CCCAGCCGGCTGGCACCCAGGGG + Intronic
1085381752 11:76126063-76126085 CCCAGCTGCCCGGGAGGCTGAGG - Intronic
1087145898 11:94811377-94811399 CCCAGCCGCTCGGGAGGCTGAGG + Intronic
1089030326 11:115320176-115320198 CCCAGCTGCTCGGGAGCCTGAGG - Intronic
1089423888 11:118353644-118353666 CCCAGCTGCCCGGGAGGCTGAGG - Exonic
1089452517 11:118608009-118608031 CCCGGCCGCCTGGGTGCCGGCGG - Intronic
1091571814 12:1693037-1693059 CCCAGCTGCCCGGGAGGCTGAGG + Intronic
1091757761 12:3066292-3066314 CCCAGCTGCCCGGGAGGCTGAGG + Intergenic
1091771752 12:3156621-3156643 CCCAGCCGCTCGGGAGGCTGAGG - Intronic
1092573311 12:9749231-9749253 CCCAGCTACCCGGGACGCTGAGG + Intergenic
1094626137 12:32125931-32125953 CCCAGCTGCTCGGGAGCCTGAGG + Intronic
1096301068 12:50428109-50428131 CCCAGCCACCCGGGAGGCTGAGG - Intronic
1096390230 12:51223099-51223121 CCCAGCTGCCCGGGAGGCTGAGG - Intergenic
1098739211 12:74150004-74150026 CCCAGCTGCCCGGGAGGCTGAGG - Intergenic
1098907049 12:76172917-76172939 CCCAGCCACTCGGGAGCCTGAGG + Intergenic
1099912874 12:88854803-88854825 CCCAGCTGCCCGGGAGGCTGAGG - Intergenic
1100046823 12:90392423-90392445 CCCAGCTGCTCGGGACACTGGGG + Intergenic
1102511864 12:113421357-113421379 CCCAGCCCCCCAGGGCCAGGCGG + Intronic
1103003242 12:117402165-117402187 CCCAGCCGCTCGGGACACTGAGG + Intronic
1103556961 12:121772242-121772264 CCCAGCCACCCGGGAGGCTGAGG - Intronic
1103562519 12:121800074-121800096 CCCGGCCGCCCGGGCCGCTGGGG - Intronic
1103764518 12:123271222-123271244 CCGAGCCGCCCAGAAGCCGGAGG + Intronic
1103907664 12:124335705-124335727 CCCAGCTGGCTGGGACCCCGGGG + Intronic
1104809913 12:131613896-131613918 CCCAGCCGCAGCCGACCCGGCGG + Intergenic
1104942064 12:132399822-132399844 CCCAGGCGTCCGGGAGCCCGCGG - Intergenic
1105296383 13:19090751-19090773 TCCAGCCCCCCGGGGCCCCGTGG + Intergenic
1105577947 13:21670447-21670469 CCCCGCTGCTCGGGTCCCGGCGG - Intergenic
1105911234 13:24869881-24869903 CCCAGCTGCTCGGGAGCCTGAGG - Intronic
1105939930 13:25138822-25138844 CCCAGCTGCCCGGGAGGCTGAGG - Intergenic
1107532521 13:41297689-41297711 CCCAGCCACTCGGGACGCTGAGG - Intergenic
1107562968 13:41573731-41573753 CCCAGCCACCCGGGAGGCTGAGG - Intronic
1110480186 13:75964837-75964859 CCCAGCCACCCGGGAGGCTGAGG + Intergenic
1111710473 13:91806149-91806171 CCCAGCCACTCGGGACGCTGAGG - Intronic
1111975903 13:94967620-94967642 CCCTGCCAGCCGGGACCCCGGGG + Intergenic
1112344043 13:98576360-98576382 CGCAGGGCCCCGGGACCCGGCGG + Intronic
1112507732 13:99985199-99985221 CCCCGCCGCCCTGGCCCCTGGGG - Intronic
1112604593 13:100891335-100891357 CCCAGCGGCTCAGGAGCCGGAGG + Intergenic
1112652701 13:101416279-101416301 CGCAGCCTCCCGGGCACCGGCGG + Intronic
1112692772 13:101916190-101916212 CCCAGCCTGCAGGGACGCGGAGG + Intronic
1113019974 13:105874088-105874110 CCCAGCCACTCGGGACGCTGAGG - Intergenic
1113895101 13:113759276-113759298 CCCAGGGGCCCGGGCACCGGCGG - Exonic
1114849003 14:26359928-26359950 CCCAGCTGCTCGGGAGGCGGAGG + Intergenic
1114910628 14:27191132-27191154 CCCAGCTTCCCGGGAGGCGGAGG + Intergenic
1118660557 14:68005167-68005189 CCCAGCTGCCCAGGAGCCTGAGG - Intronic
1119411608 14:74434965-74434987 CCCAGCTGCTCGGGAGGCGGAGG + Intergenic
1121056913 14:90863185-90863207 CCCAGCCACCCGGGAGACTGAGG + Exonic
1121342624 14:93114788-93114810 CCCAGCAGCCCAGGGCGCGGTGG - Intronic
1122143360 14:99675211-99675233 CCCAGCAGCCAGGGAGCCGGAGG + Exonic
1122504945 14:102226511-102226533 CCCTGCTGCCGGGGCCCCGGCGG - Intronic
1122546149 14:102523987-102524009 CCCAGCCGCCCACGAACCGCTGG + Intergenic
1122551590 14:102552955-102552977 CCCAGACACCTGGAACCCGGTGG - Intergenic
1122893082 14:104742010-104742032 CCCAGCCCCTCGGGACCCCGTGG + Intronic
1123004383 14:105314445-105314467 CCCCGCCCCCCGGGAGCCGCGGG - Exonic
1124468169 15:29959103-29959125 CCCAGCTGCCCGGGAGGCTGAGG - Intronic
1124922276 15:34038800-34038822 CCCAGCCTCCCGGCTCCCGGCGG + Exonic
1125049783 15:35283410-35283432 CCCAGCTGCTCGGGAACCTGAGG - Intronic
1125777458 15:42229939-42229961 CCCAGCTGCTCGGGAGCCTGAGG - Intronic
1127419926 15:58795058-58795080 CCCAGCTGCTCGGGAGGCGGAGG + Intronic
1127482494 15:59390485-59390507 CCCAGCCGCTCGGGAGGCTGAGG - Intronic
1128735758 15:70053156-70053178 CCCAGCCACTGGGGCCCCGGAGG + Intronic
1129293091 15:74583599-74583621 CCCAGCCACTTGGGAGCCGGAGG + Intronic
1129728324 15:77915416-77915438 CCCAGCCCCCCAGGAACTGGGGG - Intergenic
1130517024 15:84633547-84633569 CCGGGCCGCCCGGGACGCTGAGG + Intergenic
1130897685 15:88183680-88183702 CCCAGCCTCACGGGGCCCTGGGG - Intronic
1132265526 15:100466967-100466989 CCCAGCCACTCGGGAGCCTGAGG - Intronic
1132808384 16:1786340-1786362 CCCTGCAGCCCCAGACCCGGGGG - Intronic
1133924794 16:10183445-10183467 ACCAGACGCCCGGGAGCGGGCGG - Intergenic
1134147590 16:11778827-11778849 CCCAGCTGCCCGGGAGGCTGAGG - Intronic
1134160252 16:11882163-11882185 CCCAGCTACCCGGGAGGCGGAGG + Intronic
1134829720 16:17313292-17313314 CCCAGCAGCCAGGGGCCTGGAGG - Intronic
1135109133 16:19677179-19677201 CCCAGCTGCTCGGGAGGCGGAGG - Intronic
1136151735 16:28355640-28355662 CCCAGCCACCCGGGAGGCTGAGG + Intronic
1136167968 16:28469480-28469502 CCCAGCCACCCGGGAGGCTGAGG + Intronic
1136195006 16:28645531-28645553 CCCAGCCACCCGGGAGGCTGAGG - Intronic
1136211345 16:28759643-28759665 CCCAGCCACCCGGGAGGCTGAGG - Intronic
1136256066 16:29039598-29039620 CCCAGCCACCCGGGAGGCTGAGG - Intronic
1136309261 16:29396643-29396665 CCCAGCCACCCGGGAGGCTGAGG + Intronic
1136422904 16:30147656-30147678 CCCAGCTGCTCGGGAGCCTGAGG - Intergenic
1136437361 16:30238154-30238176 CCCAGCCACCCGGGAGGCTGAGG + Intronic
1136724791 16:32348934-32348956 CCCAGCCGCGCGCGCCCCCGCGG + Intergenic
1137733966 16:50710727-50710749 CCCAGCCACCCTGGGCCTGGAGG + Exonic
1137788006 16:51152674-51152696 CCCAGCCTTCCGGGACGAGGTGG + Intergenic
1138106588 16:54290346-54290368 ACCAGCCACCAGGGACTCGGAGG + Intergenic
1138450913 16:57092994-57093016 CCCCGCAGTCCGGGAGCCGGCGG - Intronic
1138646329 16:58427959-58427981 CCCAGCTGCCCGGGAGGCTGAGG + Intergenic
1138839589 16:60483974-60483996 CCCAGCCACCCGGGAGGCTGAGG - Intergenic
1139989940 16:70932237-70932259 CCCAGCTACCCGGGACGCTGAGG + Intronic
1140103217 16:71936601-71936623 CCCAGCTGCTCGGGAGGCGGAGG - Intronic
1140224477 16:73066874-73066896 CCCAGCCCCGCGGGATACGGAGG + Intergenic
1140498219 16:75408658-75408680 CCCAGCCACTCGGGAGCCTGAGG + Intronic
1141086018 16:81096178-81096200 CCCAGCTGCCAGGGCCTCGGCGG + Exonic
1141262455 16:82466388-82466410 CCCAGCTGCCCGGGAGACTGAGG + Intergenic
1141603653 16:85141027-85141049 CCCAGCCACTCGGGAGCCTGAGG - Intergenic
1141609578 16:85173760-85173782 CCCAGCTGCCTGGGAAACGGCGG - Intronic
1142121182 16:88387389-88387411 CCGAGTCCCCCGGCACCCGGGGG - Intergenic
1142189290 16:88710297-88710319 CCCAGCAGCCCGGGCCCACGGGG - Intronic
1142286992 16:89175532-89175554 CCCAACCCCCCGGGAGCCTGTGG - Intronic
1142358625 16:89615797-89615819 ACCAGCCGGCCAGGACCCCGGGG - Intronic
1203001639 16_KI270728v1_random:168821-168843 CCCAGCCGCGCGCGCCCCCGCGG - Intergenic
1203133242 16_KI270728v1_random:1705227-1705249 CCCAGCCGCGCGCGCCCCCGCGG - Intergenic
1142495314 17:303273-303295 CCCAGCTGCCCGGGAGGCTGAGG + Intronic
1142622783 17:1175592-1175614 CCCAGCTGCCAGGGGCCCTGGGG - Intronic
1142631534 17:1229301-1229323 TCCGGCCGCCCCGGGCCCGGCGG + Intergenic
1142670583 17:1485856-1485878 CCCGGCCGCGCGGGAGGCGGGGG - Intronic
1143632549 17:8147347-8147369 CCCAGCCCCACGGGACTCTGTGG - Exonic
1143899751 17:10165174-10165196 CCCAGCTACTCGGGACCCTGAGG + Intronic
1144776366 17:17786955-17786977 CCCAGCTACCCGGGAGGCGGAGG + Intronic
1144787407 17:17839764-17839786 CCCAGCCAACCGGGGCCCGAGGG - Intergenic
1145820163 17:27826553-27826575 CCCAGCTGCTCGGGAGCCTGAGG - Intronic
1145978121 17:28996114-28996136 CCCAGCCACCCGGGAGGCTGAGG - Intronic
1146046518 17:29512796-29512818 CCCAGCTACTCGGGAGCCGGAGG - Intronic
1146656373 17:34637486-34637508 CCCAGCCAACCAGGGCCCGGCGG + Exonic
1146715668 17:35084778-35084800 CCCAGCCGCTCGGGAGGCTGAGG + Intronic
1147015541 17:37489318-37489340 CCGTGGCGCCCGAGACCCGGAGG - Intergenic
1147123933 17:38352653-38352675 CTCAGCAGCCCGGGTCGCGGAGG + Exonic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1147179228 17:38674249-38674271 CCCAGCCGCCAGGGCGCAGGGGG + Exonic
1147218373 17:38913884-38913906 CCCAGCCGCCCAGGAGGCTGAGG + Intronic
1147227896 17:38994727-38994749 CCCAGCTGCCCGGGAGGCTGAGG - Intergenic
1147918613 17:43902814-43902836 CCCAGCTGCCCGGGCCTCAGAGG + Intronic
1148747071 17:49924407-49924429 CCCCTCCTCCCGGGCCCCGGGGG - Intergenic
1149038362 17:52158863-52158885 CTCCGCAGCCCGGCACCCGGGGG + Intronic
1149550270 17:57534597-57534619 CCCAGCCACCCGGGAGGCTGAGG + Intronic
1149689421 17:58561967-58561989 CCCAGCCACCCGGGAGGCTGAGG + Intronic
1150746620 17:67822104-67822126 CCCAGCTGCCCGGGAGGCTGAGG + Intergenic
1151701009 17:75742577-75742599 CCCAGACGCCCGGGGCATGGTGG + Exonic
1151896552 17:76984657-76984679 CCCAGCTGCCTGGGACACTGAGG - Intergenic
1152181808 17:78827009-78827031 CCAAGCCGCCCCGGACCAGCAGG + Intronic
1152230416 17:79111549-79111571 CCCAGCTGCCCGGGAGGCTGAGG - Intronic
1152572257 17:81126016-81126038 CCCAGCCCCTGGGGACCCCGGGG - Intronic
1152965644 18:111861-111883 CCCGCCCGCCCGGGCCCCTGCGG - Intergenic
1154132912 18:11751715-11751737 CCCAGCCGGCCGGGCTCCGTGGG + Intronic
1155054036 18:22169837-22169859 CCCAGGCTCCCGGGACACCGCGG + Intronic
1156181395 18:34609358-34609380 CCCAGCCGCTCGGGAGGCTGAGG - Intronic
1156439045 18:37165705-37165727 CCCAGCTACTCGGGACCCTGAGG - Intronic
1156720362 18:40062272-40062294 CCCAGCTGCTCGGGACGCTGAGG - Intergenic
1157614064 18:48976419-48976441 CCCAGCCTCCAGTCACCCGGCGG + Intergenic
1157794102 18:50559622-50559644 TGCAGCCGCCGGGGGCCCGGTGG - Intergenic
1158462427 18:57658160-57658182 CCCAGCCACTCGGGAGCCTGAGG - Intronic
1160707389 19:535958-535980 CCCAGCACCCTGGGTCCCGGAGG - Intronic
1160707415 19:536037-536059 CCCAGCGCCCCGGGTCCCGGAGG - Intronic
1160753651 19:747121-747143 CCCACCCGCCAGGACCCCGGTGG - Exonic
1160777938 19:865005-865027 CCCAGCTGCTCGGGACGCTGAGG + Intergenic
1160908676 19:1464746-1464768 CCCAGCCACCCGGGAGGCCGAGG - Intronic
1160927918 19:1555904-1555926 CCGTGGCGCCCCGGACCCGGTGG - Exonic
1160978825 19:1807176-1807198 CCGTGCCACCCGGGACCTGGTGG - Exonic
1161233323 19:3186349-3186371 CCCTGCCGCCCTGGACCCCCGGG + Intronic
1161973345 19:7596018-7596040 CGCAGCGGCCCGGGCCCGGGGGG - Exonic
1162137038 19:8561830-8561852 CCCAGCTGCCCGGGAGGCTGAGG - Intronic
1162423012 19:10576820-10576842 CCCAGCCACTCGGGACACTGAGG - Intronic
1162469525 19:10864173-10864195 CCCAGCTGCCCGGGAGGCTGAGG - Intronic
1162572017 19:11479637-11479659 CCCCGCCCCCAGGGCCCCGGGGG - Intronic
1162643943 19:12035342-12035364 ACGAGACGCCCGGGTCCCGGCGG + Intronic
1162722601 19:12671210-12671232 CCCAGCCACTCGGGAGGCGGAGG + Exonic
1162777678 19:12989863-12989885 CCCAGGAGCCCGGGGCCTGGGGG + Intergenic
1163119672 19:15209800-15209822 CCCAGCCACTCGGGACACTGAGG + Intergenic
1163247144 19:16103573-16103595 CCCAGCTACCCGGGAGGCGGAGG + Intergenic
1163304176 19:16467262-16467284 CCCGGCCACTCGGGACCCTGAGG - Intronic
1163346021 19:16742784-16742806 CCCAGCTGCTCGGGAGCCTGAGG - Intronic
1163423046 19:17225898-17225920 CCCAGCTACTCGGGAGCCGGAGG + Intergenic
1163606683 19:18279711-18279733 CCCAGCCCGCCAGGCCCCGGCGG + Intergenic
1163612257 19:18307769-18307791 CCCAGCCCCCAGGGATGCGGGGG + Intronic
1163625049 19:18384445-18384467 CCCAGCTGCTCGGGAGCCTGAGG - Intronic
1164638631 19:29809374-29809396 CCCAGCCGCTCGGGAGACTGAGG + Intergenic
1165088787 19:33371353-33371375 CCCAGCCACTCGGGAGCCTGAGG - Intergenic
1165699185 19:37924560-37924582 CCCAGCCGCTCGGGAGGCTGAGG + Intronic
1166361151 19:42253587-42253609 CCCAGCCACCCGGGAGCGAGTGG + Intronic
1166688371 19:44809147-44809169 CCCAGGCGCGCGGGGCCCCGCGG + Exonic
1166713397 19:44951387-44951409 CCCAGGCCCCGGGGACTCGGGGG - Intronic
1167751499 19:51383148-51383170 CCCAGCTACTCGGGACCCTGAGG - Intronic
1168114326 19:54212795-54212817 CCCAGCCACTCGGGAGCCTGAGG - Intronic
1168271868 19:55254532-55254554 CTCTGCCGCCAGGGAACCGGTGG + Intronic
1168345569 19:55648783-55648805 CCCAGCCGCCTAGGTCCTGGGGG - Exonic
1168361033 19:55740623-55740645 CCCAGCTGCTCGGGAGGCGGAGG + Intergenic
1168449162 19:56449564-56449586 CCCAGCCGCTCGGGAGGCTGAGG + Intronic
1202696961 1_KI270712v1_random:132502-132524 CGCAGCTGCCCGGGGCCAGGCGG - Intergenic
926440225 2:12880965-12880987 CCCAGCTGCTCGGGAGGCGGAGG + Intergenic
926914268 2:17878259-17878281 CCCAGCCGCCGGGGCCGCGGGGG + Intronic
927256316 2:21043742-21043764 CCCACTCGCCCTGGACCCTGTGG + Intronic
927508160 2:23627989-23628011 CCCAGCTCCCCGGGAAGCGGAGG - Intronic
927904747 2:26848372-26848394 CCCGGCCGCAGGGGACGCGGCGG + Intronic
930084202 2:47481613-47481635 CCCAGCTGCTCGGGAGCCTGAGG - Intronic
930457766 2:51628336-51628358 CCCAGCTACTCGGGAGCCGGAGG - Intergenic
933607680 2:84400994-84401016 CCCAGCCGCTCGGGAGGCTGAGG + Intergenic
933828783 2:86189348-86189370 CCCAGCTGCCCGGGAGGCTGAGG - Intronic
933847541 2:86337702-86337724 CCCAGCCCCCCGGGGCTCGGCGG + Intronic
934044716 2:88163192-88163214 CCCAGCTGCTCGGGAGGCGGAGG + Intergenic
934079005 2:88452147-88452169 CCCAGCTCCCCGGGCCCCGCGGG + Exonic
934278121 2:91589516-91589538 CGCAGCTGCCCGGGGCCAGGCGG - Intergenic
934547799 2:95233313-95233335 CCCAGCCACCCGGGAGGCTGAGG - Intronic
937181814 2:120003388-120003410 CCCAGCCGCTCGGGAGGCTGAGG - Intergenic
940639917 2:156334314-156334336 CCCAGCCGCCGGCGAGCTGGGGG - Intronic
942460179 2:176163049-176163071 CCCAGCCGGCCTGGACCCAGGGG - Intronic
944303646 2:198154974-198154996 CCCAGCCACCCGGGAGGCTGAGG + Intronic
944717603 2:202391090-202391112 CCCAGCTGCTCGGGAGCCTGAGG - Intronic
946020766 2:216638387-216638409 CCCAGCTGCTCGGGACTCTGAGG + Intronic
947719887 2:232363835-232363857 CCCTGCCTCCCGGGGCCCTGCGG + Intergenic
947731455 2:232433700-232433722 CCCTGCCTCCCGGGGCCCTGCGG + Intergenic
947765230 2:232633580-232633602 CCGAGGCGGCGGGGACCCGGCGG - Exonic
948210257 2:236187873-236187895 CCCAGCCGCTCGGGAAGCTGAGG - Intergenic
948454947 2:238100595-238100617 CCCAGCTGCCCGGCAACCAGCGG + Exonic
948499111 2:238378800-238378822 CCCAGCAGCCTGGGGCCTGGGGG - Intronic
948697940 2:239742781-239742803 CCCACCCTCCCGGGAGCAGGAGG - Intergenic
948803788 2:240444382-240444404 TCCAGCCGCCCAGGACCCTGCGG + Intronic
1171959841 20:31485692-31485714 CCCAGACGCCCCAGCCCCGGGGG + Intergenic
1175402464 20:58708353-58708375 CCCAGCCGGTGGGGACACGGAGG + Intronic
1175715749 20:61253200-61253222 CCCAGCCCCCGGGGCCCCGCCGG - Intronic
1175847025 20:62064841-62064863 CCCGGCCGCCGGGGGCCCCGCGG - Exonic
1175866839 20:62183139-62183161 CCCAGCGCCCCGGTACCCCGCGG - Intronic
1175924006 20:62463157-62463179 CTCAGCCGCTGGGGACCTGGGGG + Intergenic
1176190014 20:63804094-63804116 CCCAGCCACCAGGGTCTCGGTGG + Intronic
1176366197 21:6034280-6034302 CCCAGCAGCCTGGGCCCTGGGGG - Intergenic
1176412755 21:6457846-6457868 CCGAGCCTGCCGGGACCCGGGGG - Intergenic
1176798515 21:13396198-13396220 CCCAGCTACTCGGGACACGGAGG - Intergenic
1178502018 21:33133383-33133405 CCCAGCTACTCGGGACCCTGAGG + Intergenic
1179688249 21:43066168-43066190 CCGAGCCTGCCGGGACCCGGGGG - Intronic
1179757320 21:43504265-43504287 CCCAGCAGCCTGGGCCCTGGGGG + Intergenic
1179800994 21:43811430-43811452 CCCAGCTGCCCAGGCCCCAGAGG + Intergenic
1179833351 21:44012204-44012226 GCCGGCCGCGCGGGACCGGGAGG - Intergenic
1179895863 21:44362887-44362909 CCCAGCCACTCGGGACGCTGAGG - Intronic
1180622560 22:17171740-17171762 CGCAGCCACCCGGGGCCCGGGGG + Intergenic
1181026744 22:20131525-20131547 CTCCGCGGCCCGGGACCAGGGGG + Intronic
1181107733 22:20584812-20584834 GTCAGCAGCCCGGGACCCGAGGG - Intronic
1181544474 22:23593681-23593703 CCCAGCCACCCGGGAGGCTGAGG + Intergenic
1181585224 22:23849423-23849445 TCCAGCCGCGCGGGGCCGGGTGG - Intergenic
1181744897 22:24949238-24949260 CCCAGCTGCTCGGGAGCCTGAGG + Intergenic
1181811384 22:25405522-25405544 CCCAGCGGCCCGGGTCCCCGCGG + Intergenic
1182355344 22:29720244-29720266 CCCGGCGGCCCGGGGCGCGGGGG + Exonic
1183063412 22:35348797-35348819 CCCAGGAGCCCAGGACCCTGTGG - Intergenic
1183488907 22:38106402-38106424 CCCAGCCGCTCGGGAGGCTGAGG + Intronic
1183499522 22:38170080-38170102 CCCAGCTGCCCGGGAAGCTGAGG + Intronic
1183517042 22:38272751-38272773 CCTCCCCGCCCGGGAGCCGGCGG + Intronic
1183549381 22:38472359-38472381 CCCAGCCACCCGGGAGGCTGAGG + Intronic
1183692747 22:39400028-39400050 CCCCGGCGCCCTTGACCCGGGGG - Intronic
1184111002 22:42395056-42395078 CCCAGCCACCCGGGAGGCTGAGG + Intronic
1184207429 22:43014370-43014392 CCCCCCCCCCCGGGACACGGAGG + Intronic
1184258013 22:43298017-43298039 CTCAGCCCCCTGGGACCAGGTGG - Intronic
1184552801 22:45213470-45213492 CCCAGGCTCACAGGACCCGGGGG + Intronic
1184731542 22:46373610-46373632 TTCAGCCTCCCGGGACCCAGAGG - Intronic
1184767061 22:46577474-46577496 CCGTGACGCGCGGGACCCGGGGG - Intronic
1184859626 22:47165754-47165776 CCCTGCCCCCCGGACCCCGGGGG + Intronic
1185021268 22:48377644-48377666 CCCAGCAGCCGGGGACCTGAAGG + Intergenic
1185044341 22:48521644-48521666 GCCAGCCGCACGGGAGACGGAGG + Intronic
1185251039 22:49801853-49801875 CCCAGCTGCCTGGGTCCCCGTGG + Intronic
1185317380 22:50185034-50185056 CCGGGGCGGCCGGGACCCGGCGG - Intergenic
1185370563 22:50459094-50459116 CCCTGCCCCACGGCACCCGGAGG + Intronic
1185420197 22:50730769-50730791 CCCCGCCGCCCGGGCCCCCGGGG - Intergenic
950474098 3:13204914-13204936 CCCAGCCGCTCGGGAGGCTGAGG - Intergenic
950857446 3:16119050-16119072 CCCAGCTGCTCGGGACGCTGAGG + Intergenic
952468477 3:33618062-33618084 CCCAGCCGCTCGGGAAGCTGAGG - Intronic
952759191 3:36898733-36898755 CCCAGCCGCTCGGGAGGCTGAGG + Intronic
953705125 3:45225461-45225483 CCGAGCCGCCCGGGCCGCTGTGG - Exonic
954213551 3:49111705-49111727 CCCAGCCTCCAGGGAACCTGTGG + Exonic
954683663 3:52359241-52359263 CCCAGATGCCCAGGACCCAGTGG + Exonic
957048829 3:75396322-75396344 TCCAGCCGCGCGGACCCCGGGGG - Intergenic
958432589 3:94059938-94059960 CCCAGCCACCCAGGAGCCTGAGG + Exonic
958807625 3:98831153-98831175 CCCAGCTACCCGGGAGGCGGAGG - Intronic
960431291 3:117571686-117571708 CCCAGCCACTCGGGAGCCTGAGG - Intergenic
961162405 3:124740159-124740181 CCCAGTGGCCAGGGAGCCGGTGG - Exonic
961402040 3:126654637-126654659 CGCCGCAGCCCGGGACCCGCGGG + Intronic
961688419 3:128651163-128651185 CCCAGCCACCCGGGAGGCTGAGG - Intronic
962220350 3:133559684-133559706 CCCAGCTACTCGGGAGCCGGAGG + Intergenic
962469495 3:135693028-135693050 CCCAGCCGCTCGGGAGGCTGTGG + Intergenic
963189012 3:142448125-142448147 CCCGGCCGCGCGAGGCCCGGAGG - Intergenic
964354876 3:155840867-155840889 CCCAGCTGCCCGGGAGACTGAGG + Intronic
966732555 3:183162866-183162888 CCCAGAGGCCCGGGCCCCGGCGG - Exonic
966866503 3:184261446-184261468 CCCAGCGGCCCGGGAGGCGGAGG - Exonic
967142011 3:186569432-186569454 CCCAGCTGCTCGGGAGCCTGAGG - Intronic
967480028 3:189962288-189962310 CCCAGCTGCTCGGGAGCCTGAGG - Intronic
967619237 3:191612177-191612199 CCCAGCTACCCGGGACGCTGAGG + Intergenic
967880719 3:194299402-194299424 CCCAGCCACTCGGGAGCCTGAGG - Intergenic
968114287 3:196077634-196077656 CCCAGCCACTCGGGAGCCTGAGG + Intronic
968743351 4:2342507-2342529 CCCAGCCGCTCGGGAGGCTGAGG - Intronic
968803100 4:2755940-2755962 CTCACCCACCCAGGACCCGGCGG + Intronic
969716557 4:8870951-8870973 CCCAGCCTCCCTGGGACCGGAGG + Intronic
971257932 4:25030889-25030911 CCCAGCAGCCCGGGCTCGGGTGG - Intergenic
971786189 4:31105889-31105911 CCCAGCTGCTCGGGACGCTGAGG + Intronic
972437212 4:39045245-39045267 CCCAGCCCCTCCGGACCCGAGGG - Intronic
973248501 4:48036810-48036832 TCCAGCCACCCGGGAGCCTGAGG + Exonic
976124529 4:81819282-81819304 CCCAGCCACTCGGGAGCCTGAGG + Intronic
976964137 4:91013716-91013738 CCCAGCTGCTCGGGAGCCTGAGG - Intronic
977233002 4:94474364-94474386 CCCAGCCGCTCGGGAGGCTGAGG - Intronic
978761380 4:112358507-112358529 ACCAGCTGCTGGGGACCCGGAGG + Intronic
979227342 4:118302540-118302562 CCCAGCCGCTCGGGAGGCTGAGG - Intronic
979709167 4:123757417-123757439 CCCAGCCACTCGGGAGCCTGAGG - Intergenic
981093328 4:140755808-140755830 CCCAGCCCCAGGGGACCGGGCGG + Intronic
982027395 4:151264313-151264335 CCCAGCCACCCGGGAGGCTGAGG + Intronic
984661025 4:182375655-182375677 CCCAGCTGCCCAGGAGGCGGAGG - Intronic
985647611 5:1092404-1092426 CCCACCCTCCCTGGACCTGGGGG + Intronic
985995562 5:3595398-3595420 CCCGGCCGCGCGGGACTCGGGGG + Intergenic
987374017 5:17217834-17217856 CCGCGCCGCCGCGGACCCGGGGG + Intronic
991927413 5:71719105-71719127 CCCAGGCGCCTGGAACCCGGCGG + Intergenic
995142538 5:108749296-108749318 CCCACCATCCCGGGACCCGAAGG + Intronic
995650408 5:114362360-114362382 CCCCGCCGCCGGGGCACCGGAGG - Exonic
997470559 5:134114872-134114894 CCCAGCGCCCCGCGCCCCGGCGG + Exonic
997583708 5:135032925-135032947 CGCAGCCGGCCGGGTTCCGGAGG - Intronic
997584122 5:135034540-135034562 ACGAGCCGCCCGGGACTCGCAGG - Intronic
998261451 5:140634896-140634918 CCCAGCCGCTCGGGAAGCTGAGG - Intergenic
998407683 5:141883219-141883241 GGCAGCCCCCGGGGACCCGGTGG + Intergenic
998823227 5:146075693-146075715 CCCAGCTACCCGGGAGGCGGAGG + Intronic
999088351 5:148912945-148912967 CCCAGCCCTCCTGGAACCGGTGG + Intergenic
999299743 5:150484007-150484029 CCCAGCCACTCGGGAGCCTGAGG - Intergenic
1000622962 5:163505806-163505828 CAAAGCCGCCCGAGCCCCGGTGG - Intronic
1001920716 5:175597186-175597208 CCCAGCGTCCCAGGCCCCGGGGG - Intergenic
1001982557 5:176046892-176046914 CACAGCCACCTGGGACCTGGTGG - Intergenic
1002021169 5:176365393-176365415 GCAGGCCGCCCGGGACCCGGCGG - Intergenic
1002234904 5:177797165-177797187 CACAGCCACCTGGGACCTGGTGG + Intergenic
1002422716 5:179157619-179157641 CCCAGCCACTCGGGAACCTGAGG - Intronic
1002457043 5:179351175-179351197 CCCTGCAGCCAGGGACCCAGGGG + Intergenic
1002823596 6:752850-752872 CCCAGCCACCCGGGAGGCTGAGG - Intergenic
1003661201 6:8064161-8064183 CGCGCCAGCCCGGGACCCGGGGG + Intronic
1005269735 6:24150674-24150696 CCCAGCCGCTCGGGAGGCTGAGG + Intronic
1005514313 6:26539383-26539405 CCCAGCTGCTCGGGAGCCTGAGG - Intronic
1005966669 6:30731367-30731389 CCCAGCCACCCGGGAGGCTGAGG + Intronic
1006129835 6:31862536-31862558 CTCAGCCGCCCGCGTTCCGGGGG + Intronic
1006134265 6:31886534-31886556 CCCAGGCACCAGGGACCCAGAGG + Intronic
1006386954 6:33736518-33736540 CCCAGCTGCTCGGGAGCCTGAGG - Intronic
1006598678 6:35211893-35211915 CCAACCCCCCAGGGACCCGGAGG + Intergenic
1006604652 6:35247320-35247342 CCCAGCTACTCGGGACCCTGAGG + Intronic
1006651056 6:35551944-35551966 CCCAGCTGCTCCGGACCCTGAGG + Intergenic
1007169111 6:39850036-39850058 CCCAGCCCCAGGGGACCTGGTGG + Intronic
1008106976 6:47449502-47449524 CCCAGCCACCCGGGAGGCTGGGG + Intergenic
1011468258 6:87681151-87681173 CCCAGCCCCTCGGGAGCCTGAGG - Intronic
1013236324 6:108200242-108200264 TCCAGCCTCCCGGGCCCCGGGGG - Intergenic
1014153636 6:118087015-118087037 CCCAGTCCCCCGGGACCCTAAGG + Intronic
1014437023 6:121432029-121432051 CCCAGCCTCCCGGGAGGCTGAGG - Intergenic
1014993897 6:128117028-128117050 CCCAGCTGCTCGGGAGGCGGAGG + Intronic
1016797525 6:148133709-148133731 CCCAGCCACCCGGGAGGCTGAGG + Intergenic
1017041287 6:150310299-150310321 CCCACCCACCCGGGGCACGGTGG + Intergenic
1017045976 6:150347612-150347634 CCCAGCCGCACGGGAGGCTGAGG - Intergenic
1018017819 6:159727621-159727643 CCCTGCCGCCCGGGCCCCCCGGG - Intronic
1019891731 7:3952465-3952487 CCCAGCCACTCGGGAGGCGGAGG + Intronic
1020023533 7:4883332-4883354 CCCAGCCTGCGGGGATCCGGGGG - Intronic
1020096187 7:5370855-5370877 CACCGCCGCCCTGGACCTGGGGG - Exonic
1020145329 7:5637959-5637981 CCCAGCTGCTCGGGAGCCTGAGG - Intronic
1020398155 7:7741459-7741481 CCCAGCCACCCGGGAGGCTGAGG + Intronic
1021867946 7:24977738-24977760 CCCAGCCACCCGGGAGGCTGAGG + Intronic
1022375519 7:29807467-29807489 CCCGGCCGCCCTGGACCTGGAGG + Intronic
1025076712 7:55950116-55950138 CCCAGCCACCCGGGATGCTGAGG + Intergenic
1025144333 7:56491753-56491775 CCCAGGAGCCCGGGTCCCTGGGG - Intergenic
1025779008 7:64582769-64582791 CCCAGCTGCCAGGGCCTCGGCGG - Intergenic
1026948936 7:74334420-74334442 CCCAGCTGTCCGGGCCCAGGCGG - Intronic
1027121796 7:75527590-75527612 CCCGGCCTCTCGGGAGCCGGGGG - Intergenic
1027410075 7:77906790-77906812 CCCAGCCACTCGGGAGCCTGAGG + Intronic
1028552205 7:92081418-92081440 CCCAGCCGCCTGGGAGGCCGAGG - Intronic
1028753567 7:94409747-94409769 CCCGGCCTCCCTGGACCCCGCGG + Exonic
1029482128 7:100819692-100819714 CCCCGGCCCCCGGGACCTGGTGG - Exonic
1029640328 7:101816176-101816198 CCCAGCCGCCGGGGGGCCCGCGG + Intronic
1030047492 7:105510627-105510649 CCCAGCCACCCGGGAGGCTGAGG - Intronic
1030321420 7:108172409-108172431 CCTAGCTGCCCGGGAGGCGGAGG - Intronic
1030655982 7:112168587-112168609 CCCAGCCACCTGGGAACCTGAGG + Intronic
1031025239 7:116672383-116672405 CCCGGCCGCAGGTGACCCGGAGG + Exonic
1032633341 7:133678724-133678746 CCCAGCCACCTGGGAGCCTGAGG - Intronic
1033130350 7:138740555-138740577 CCCAGCTGCTCGGGAGCCTGAGG - Intronic
1033200859 7:139368620-139368642 CCCAGCCACCCGGGAGGCTGAGG + Intronic
1033382866 7:140840673-140840695 CCCAGCTGCCCGGGAGGCTGAGG + Intronic
1033975118 7:147091719-147091741 CCCAGCTACCCGGGACGCTGAGG - Intronic
1034431413 7:151043145-151043167 CCCAGCCTCCCGGGTCTCTGTGG - Intronic
1035091431 7:156316177-156316199 CCCAGCCACTCGGGAGGCGGAGG - Intergenic
1035579647 8:731753-731775 CCCAGCCCCCAGGCACCTGGAGG + Intronic
1036453320 8:8888390-8888412 CCCACCCCCAGGGGACCCGGAGG - Intronic
1036789494 8:11708650-11708672 GGCGGCCGCCAGGGACCCGGTGG - Exonic
1037798763 8:22019316-22019338 CCCAGCTACCCGGGAGCCTGAGG + Intergenic
1037815378 8:22109185-22109207 CGCAGCCGCACGGGCGCCGGCGG + Exonic
1037980025 8:23246725-23246747 CCCAGCCGGGGGAGACCCGGCGG + Exonic
1038295944 8:26291363-26291385 CCCTGCCGGCCGGGACACGGAGG + Intergenic
1038789715 8:30657882-30657904 CTCAGCCTCCCGGGAGGCGGCGG + Intronic
1042356275 8:67831357-67831379 CCCAGCTGCTCGGGAGGCGGGGG + Intergenic
1042733026 8:71957910-71957932 CCCAGCCCCCTGGGCCCCAGAGG + Intronic
1043502962 8:80874332-80874354 CGCCGCCGCCCGGGAGCCGCGGG + Intronic
1045163740 8:99579811-99579833 CCCAGCAACCCGGGACGCTGAGG - Intronic
1045298652 8:100892625-100892647 GCCAGCCGCCCCGGTCCGGGAGG - Intergenic
1045792529 8:106001275-106001297 CCCAGCCACCCGGGAGGCTGAGG - Intergenic
1046848944 8:118951752-118951774 CCCAGGCGCCGGGCACCCGTCGG + Intronic
1047212878 8:122854056-122854078 CCGAGCCTCCCGGGCCCCTGAGG + Intronic
1047959733 8:130002343-130002365 CCCAGCTGCTCGGGACGCTGAGG + Intronic
1047974301 8:130113895-130113917 CCCAGCTGCCCGGGAGGCAGAGG - Intronic
1048214116 8:132480430-132480452 CCCAGCCGGAGGGGACGCGGCGG - Exonic
1049577679 8:143397219-143397241 CCCTGCCGCCCAGCACCCTGTGG - Intergenic
1049581438 8:143412927-143412949 CCCAGCCACAGGGGACCCTGGGG + Intergenic
1049852946 8:144843932-144843954 CCCAGCCACCCAGGACCAGAGGG + Intronic
1052921912 9:33977776-33977798 CCCAGCCGCTCGGGAGACTGAGG - Intronic
1053408958 9:37903651-37903673 CCCAGTCTCCCGGGACGCAGAGG + Exonic
1055308211 9:74952254-74952276 CCCGGGCGCCCGGCTCCCGGGGG - Exonic
1055644454 9:78349841-78349863 CCCAGCTACCCGGGAGGCGGAGG - Intergenic
1056488656 9:87084154-87084176 CTCAGCCGCCAGTCACCCGGGGG + Intergenic
1057229447 9:93310846-93310868 CCCAGCCACCCGGGAGGCTGAGG + Intronic
1057411338 9:94818876-94818898 CCCAGCCACTCGGGACGCTGAGG + Intronic
1057626188 9:96679298-96679320 CCCAGCCACCCGGGAGGCTGAGG + Intergenic
1058033950 9:100230632-100230654 CCCAGCTACCCGGGACGCTGAGG - Intronic
1059302251 9:113323375-113323397 CCCAGCCACCCGGGAGGCTGAGG - Intronic
1059430131 9:114245021-114245043 CCCAGCCACCCGTGAGCTGGTGG + Intronic
1060074348 9:120578680-120578702 CCCAGCCGCTCGGGAGGCTGAGG - Intronic
1061056786 9:128227127-128227149 CCCAGCCACCCGGGAGGCTGAGG - Intronic
1061190790 9:129081449-129081471 ACCGGCGCCCCGGGACCCGGGGG - Intronic
1061947986 9:133919499-133919521 GCCAGCCGACCTGGCCCCGGGGG - Intronic
1061959332 9:133980065-133980087 ACCAGCCACCCGGGAGCAGGAGG + Intronic
1062077610 9:134600333-134600355 CCCAGCTGCCCTGGACGGGGTGG + Intergenic
1062395579 9:136351327-136351349 CCCAGCCTCCCTGGGCCTGGAGG + Intronic
1062625877 9:137441377-137441399 CCCAGCTGTCCTGGACCCAGGGG - Exonic
1203769171 EBV:40338-40360 CCGAGCCACCAGGGGCCCGGCGG + Intergenic
1185452454 X:290071-290093 CCCAGCTGCCCGGGAGGCTGAGG - Intronic
1185458299 X:321379-321401 CCCAGCTGCTCGGGACGCTGAGG + Intergenic
1185458326 X:321521-321543 CCCAGCTGCTCGGGACGCTGAGG + Intergenic
1185458353 X:321661-321683 CCCAGCTGCTCGGGACGCTGAGG + Intergenic
1185458380 X:321801-321823 CCCAGCTGCTCGGGACGCTGAGG + Intergenic
1185458405 X:321954-321976 CCCAGCTGCTCGGGACGCTGAGG + Intergenic
1185458430 X:322108-322130 CCCAGCTGCTCGGGACGCTGAGG + Intergenic
1185458457 X:322250-322272 CCCAGCTGCTCGGGACGCTGAGG + Intergenic
1185458482 X:322407-322429 CCCAGCTGCTCGGGACGCTGAGG + Intergenic
1185458507 X:322562-322584 CCCAGCTGCTCGGGACGCTGAGG + Intergenic
1186638206 X:11428022-11428044 CCCACCCTCCCCGGACCCGTGGG + Intronic
1187366423 X:18669373-18669395 CCCAGCCACTCGGGAGCCTGAGG + Intronic
1187538212 X:20163782-20163804 CCCAGCTGCTCGGGAGCCTGAGG - Intronic
1187704464 X:21995799-21995821 CCCAGCCACCCGGGAGCCTGAGG - Intergenic
1190108293 X:47574095-47574117 CCCAGCGGCCCGGGCCCCGCTGG - Exonic
1190770621 X:53511152-53511174 CCCAGCCACCCGGGAGGCTGAGG - Intergenic
1190828226 X:54037361-54037383 CCCAGCTGCCCGGGAGGCTGAGG - Intronic
1190833748 X:54081656-54081678 CCCAGCCACTCGGGAGGCGGAGG + Intronic
1192554617 X:72079918-72079940 CACAGCCACCCTGGACCCGTCGG - Intergenic
1196683913 X:118495297-118495319 CCTAGCCGCCTGGGCCCTGGGGG + Intergenic
1196857555 X:119998699-119998721 CCCAGCCGCTCGGGAGGCTGAGG - Intergenic
1198423983 X:136497024-136497046 CCGATCCGCCGGGGACCCCGCGG + Intergenic
1199112499 X:143951468-143951490 CCCAGCTGCCCGGGAGGCTGAGG + Intergenic