ID: 916651695

View in Genome Browser
Species Human (GRCh38)
Location 1:166839702-166839724
Sequence CGCAACAAAGGCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 248}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916651695_916651714 23 Left 916651695 1:166839702-166839724 CCGCCGCCGCCGCCTTTGTTGCG 0: 1
1: 0
2: 4
3: 22
4: 248
Right 916651714 1:166839748-166839770 GCCGGCTCTCGCCGCCCGGCAGG 0: 1
1: 0
2: 0
3: 25
4: 171
916651695_916651707 -4 Left 916651695 1:166839702-166839724 CCGCCGCCGCCGCCTTTGTTGCG 0: 1
1: 0
2: 4
3: 22
4: 248
Right 916651707 1:166839721-166839743 TGCGGGCCCGCCGGGGAGGCGGG 0: 1
1: 0
2: 0
3: 24
4: 298
916651695_916651706 -5 Left 916651695 1:166839702-166839724 CCGCCGCCGCCGCCTTTGTTGCG 0: 1
1: 0
2: 4
3: 22
4: 248
Right 916651706 1:166839720-166839742 TTGCGGGCCCGCCGGGGAGGCGG 0: 1
1: 0
2: 0
3: 12
4: 173
916651695_916651711 5 Left 916651695 1:166839702-166839724 CCGCCGCCGCCGCCTTTGTTGCG 0: 1
1: 0
2: 4
3: 22
4: 248
Right 916651711 1:166839730-166839752 GCCGGGGAGGCGGGCGGCGCCGG 0: 1
1: 0
2: 20
3: 200
4: 1316
916651695_916651708 -1 Left 916651695 1:166839702-166839724 CCGCCGCCGCCGCCTTTGTTGCG 0: 1
1: 0
2: 4
3: 22
4: 248
Right 916651708 1:166839724-166839746 GGGCCCGCCGGGGAGGCGGGCGG 0: 1
1: 0
2: 8
3: 81
4: 779
916651695_916651705 -8 Left 916651695 1:166839702-166839724 CCGCCGCCGCCGCCTTTGTTGCG 0: 1
1: 0
2: 4
3: 22
4: 248
Right 916651705 1:166839717-166839739 TTGTTGCGGGCCCGCCGGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 74
916651695_916651713 19 Left 916651695 1:166839702-166839724 CCGCCGCCGCCGCCTTTGTTGCG 0: 1
1: 0
2: 4
3: 22
4: 248
Right 916651713 1:166839744-166839766 CGGCGCCGGCTCTCGCCGCCCGG 0: 1
1: 0
2: 4
3: 20
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916651695 Original CRISPR CGCAACAAAGGCGGCGGCGG CGG (reversed) Intronic