ID: 916651830

View in Genome Browser
Species Human (GRCh38)
Location 1:166840155-166840177
Sequence GGAGTGCGGATGCATCTTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916651830_916651836 7 Left 916651830 1:166840155-166840177 CCCTCAAGATGCATCCGCACTCC 0: 1
1: 0
2: 0
3: 11
4: 96
Right 916651836 1:166840185-166840207 GGAATTGCCCGCGCCCATAGAGG 0: 1
1: 0
2: 0
3: 3
4: 18
916651830_916651838 12 Left 916651830 1:166840155-166840177 CCCTCAAGATGCATCCGCACTCC 0: 1
1: 0
2: 0
3: 11
4: 96
Right 916651838 1:166840190-166840212 TGCCCGCGCCCATAGAGGGCAGG 0: 1
1: 0
2: 0
3: 0
4: 69
916651830_916651841 19 Left 916651830 1:166840155-166840177 CCCTCAAGATGCATCCGCACTCC 0: 1
1: 0
2: 0
3: 11
4: 96
Right 916651841 1:166840197-166840219 GCCCATAGAGGGCAGGAGTGCGG 0: 1
1: 0
2: 2
3: 30
4: 288
916651830_916651837 8 Left 916651830 1:166840155-166840177 CCCTCAAGATGCATCCGCACTCC 0: 1
1: 0
2: 0
3: 11
4: 96
Right 916651837 1:166840186-166840208 GAATTGCCCGCGCCCATAGAGGG 0: 1
1: 0
2: 0
3: 1
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916651830 Original CRISPR GGAGTGCGGATGCATCTTGA GGG (reversed) Exonic
901963674 1:12848251-12848273 GGAGTGAGGATCCATCTTGTTGG + Exonic
901984222 1:13061341-13061363 GGAGTGAGGATCCATCTTGTTGG - Exonic
901991317 1:13116362-13116384 GGAGTGAGGATCCATCTTGTTGG + Intergenic
901997589 1:13165429-13165451 GGAGTGAGGATCCATCTTGTTGG + Exonic
908716366 1:67074194-67074216 GGAGTGCAGGGGCATCTTAAAGG + Intergenic
908850890 1:68374773-68374795 GAAGAGTGGATTCATCTTGATGG - Intergenic
913214380 1:116608248-116608270 GGAGTTCAGATGCATCCTGGAGG - Exonic
913385618 1:118255374-118255396 GGAGGGCGAATACATTTTGATGG + Intergenic
916651830 1:166840155-166840177 GGAGTGCGGATGCATCTTGAGGG - Exonic
916764304 1:167845475-167845497 GGAGTGGGTGTGGATCTTGAGGG - Intronic
920580853 1:207106236-207106258 AGAGTTAGGATGCATCCTGATGG + Intronic
921154836 1:212431679-212431701 GGAGTGGGGGTGGATCTTGGGGG - Intergenic
1065432409 10:25673014-25673036 GTAGTGTGGATGCCTTTTGATGG - Intergenic
1065825816 10:29570143-29570165 GGACTGAGGATGTATTTTGATGG - Intronic
1071548661 10:86548856-86548878 GGGGTGCTGGTCCATCTTGAGGG - Intergenic
1073435561 10:103513783-103513805 GGGGTGCGGATGAATCTGGCTGG + Intronic
1079115593 11:17638691-17638713 GGAGTGCGGATGCAGAAGGAAGG - Intronic
1079413782 11:20213620-20213642 GAAGTGAGAATGCATGTTGAGGG - Intergenic
1083201600 11:61124107-61124129 GGAGGGCGGAGGCTTCTTGATGG + Intronic
1084744885 11:71163466-71163488 GCAGAGCTGATGCTTCTTGAGGG + Intronic
1086001016 11:81986663-81986685 GGAGTGCGGGTGCACCGTGTGGG - Intergenic
1091774176 12:3173544-3173566 GGAGTGCGGTTGCATGATCATGG + Intronic
1092530172 12:9337394-9337416 GGAGGGCGGAGGTATCTGGAGGG + Intergenic
1096123825 12:49105598-49105620 GGAGTGGGGATGCACATTGATGG - Intronic
1097253753 12:57656140-57656162 GGAGTGCGGGTGCATGGTGTGGG + Intergenic
1100095217 12:91025712-91025734 GGAGTGGGGATGCTTCTCCAGGG + Intergenic
1101865800 12:108518493-108518515 GAAGTCCGGGTCCATCTTGAGGG - Exonic
1103599379 12:122044457-122044479 GGAGTGCGGAGGCATGATCATGG - Intronic
1105218112 13:18301758-18301780 GGAGTTCAGATGCATCCTGGAGG - Intergenic
1106080018 13:26492514-26492536 GTAGTGCCGATGCAGATTGAGGG + Intergenic
1107804118 13:44138309-44138331 GGAGTGCGGAGGCATGCTCACGG + Intergenic
1109854228 13:68107703-68107725 GGAGTGCGGGTGCACAGTGAGGG - Intergenic
1113724274 13:112587114-112587136 AGAGTGAGGATGCACCATGAGGG - Intronic
1113870376 13:113555643-113555665 GGAGTGCGGTGGCATGATGATGG - Intergenic
1117710265 14:58521239-58521261 GGAGTGAGGATCCGTCTTGTCGG - Intronic
1118112329 14:62735597-62735619 GGATTGTGGATGTATTTTGAAGG - Intronic
1119762689 14:77163107-77163129 GGAGAGTGGTTGCCTCTTGAGGG - Intronic
1120372656 14:83656283-83656305 GGAGTGTGGGTGAATGTTGAGGG + Intergenic
1122630493 14:103105502-103105524 GGAGTGTGGATGGCTCTTCAAGG + Intronic
1128917812 15:71581023-71581045 GGAGTGCAGATGACTCTTCAAGG + Intronic
1129322147 15:74781474-74781496 GGAGTGCGGAGGGAGCTTGGTGG - Intergenic
1130144916 15:81266752-81266774 GGAGTGCAGTTGCTTCCTGATGG - Intronic
1133362590 16:5186348-5186370 GGAGTGCGGATGCATGGCGCGGG - Intergenic
1134412637 16:14015768-14015790 GGAGTGAGCCTGCATCTTTAAGG - Intergenic
1143175327 17:4951740-4951762 GGAGTGGGGAAGAATCTTAAAGG + Intronic
1151941033 17:77292099-77292121 GGGGTACAGATGCGTCTTGAGGG - Intronic
1152945416 17:83195190-83195212 GGAGTGAGGAGGCCTCTTGTGGG + Intergenic
1157503192 18:48205000-48205022 GGAGTGGGGAGCAATCTTGAGGG + Intronic
1163152655 19:15424334-15424356 GGGCTGCGGAGGCATCTGGAGGG + Exonic
1165313765 19:35042628-35042650 GGGGTGGGGATGCATCTGGGAGG - Intronic
1165991702 19:39818950-39818972 GGAGTCTGGGTGCATTTTGAAGG - Intergenic
1166066144 19:40360225-40360247 GGGGTCTGGATGCATTTTGAAGG - Intronic
1166702063 19:44887985-44888007 GGAGTGAGGTGGCATCTTGTTGG + Intronic
1167728835 19:51237944-51237966 GGGTTCCGGATACATCTTGAAGG + Intronic
1168378780 19:55902545-55902567 GGAGTGCGGGAGCTTGTTGAGGG - Intronic
926356258 2:12043419-12043441 GGAAAGATGATGCATCTTGATGG + Intergenic
930395541 2:50819209-50819231 GAAGTGCAGATGCCTCTTCAGGG - Intronic
934537311 2:95145869-95145891 GGAGTGAGGATTTATCTTGTAGG - Intronic
934897892 2:98134329-98134351 GGCCTGCGGATGCAGCTTGAGGG + Intronic
941438967 2:165509493-165509515 AGATTGAGGATGCATCTTGAAGG + Intronic
1169445625 20:5668980-5669002 GGATTCTGGATGTATCTTGAAGG + Intergenic
1172068011 20:32235176-32235198 GCAGTGGGGATGGCTCTTGAGGG - Exonic
1172248188 20:33460495-33460517 GGAGTGCAGAGGCATCATCACGG - Intergenic
1174752405 20:53124384-53124406 GCAGTGCTGATGCATCTGGAAGG + Intronic
1175468016 20:59205619-59205641 GGACTGCGGCTGGATCTTGGCGG + Intronic
1183298048 22:37043703-37043725 GGAGTGGGGATGCAGGTAGAAGG - Intergenic
1184124773 22:42479360-42479382 GGAGTGCGGTAGCATGTTCACGG + Intergenic
1184612865 22:45616322-45616344 GGAGTCAGGATGCCTCTAGAGGG - Intergenic
1185340807 22:50290233-50290255 GGAGTGCGGCAGCCTCTTCAAGG - Exonic
949536531 3:5000353-5000375 GGAGTGAGGATGCATTTTTATGG - Intergenic
949828102 3:8184408-8184430 GCAGTGTGGATGCATCTCAAAGG - Intergenic
957074146 3:75588131-75588153 GGAGTGCGGGCGCATGGTGAGGG + Intergenic
964407118 3:156360828-156360850 GGAATTCGGATACATTTTGAAGG - Intronic
975454564 4:74575061-74575083 GCAGTGGGGATGCATCCTGATGG + Intergenic
978738682 4:112113356-112113378 AGAGTGCGAATGTATGTTGAAGG - Intergenic
981778292 4:148395358-148395380 AGAGTGAGGATTCATCTAGATGG - Intronic
986030728 5:3890392-3890414 GGAGTGGTGAAGCTTCTTGATGG - Intergenic
997180905 5:131827986-131828008 GGAGTGCGGTGGCATGTTCACGG - Intronic
998187166 5:139989476-139989498 GGAGTGAGGATTCAGGTTGATGG - Intronic
998195933 5:140071363-140071385 GGAGTGGGGATTCAGGTTGATGG + Intergenic
1000053251 5:157580264-157580286 GGAGTGCGGATGATTTTTGGGGG - Intergenic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1001591691 5:172869832-172869854 TGAGTCCAGATGCATCTTAAAGG - Intronic
1007414499 6:41683879-41683901 AGAGTGCGGATGCTGCCTGAAGG - Intergenic
1014177842 6:118349519-118349541 GGAGGGCGGCTGCCTCTTGGGGG + Intergenic
1021600233 7:22357019-22357041 GCACGGCGGCTGCATCTTGACGG + Intronic
1029311571 7:99671837-99671859 GGAATGGGTCTGCATCTTGATGG + Intronic
1035157311 7:156924729-156924751 GGGGTGCGGATGAAGCTGGATGG + Intergenic
1040730611 8:50442519-50442541 GGAGTGAGGATGCCTCTGAAAGG - Intronic
1044379264 8:91514548-91514570 TGAGTACTTATGCATCTTGAAGG + Intergenic
1045254222 8:100506141-100506163 GGATTGTGGATGTATTTTGAAGG - Intergenic
1049738427 8:144222283-144222305 GGAGTTGGGGTGCAGCTTGATGG + Intronic
1056061684 9:82889756-82889778 GTAGTGAGGCTGTATCTTGAGGG - Intergenic
1056799597 9:89681629-89681651 GGAGTGCGGGTGCACCGTAAGGG + Intergenic
1059838862 9:118189893-118189915 TGAGTGCGGAGGCCTCATGATGG + Intergenic
1062413368 9:136435684-136435706 CGTGTGCGGTTGCCTCTTGACGG - Intronic
1185737421 X:2503907-2503929 GGAGTGGGGATGCATCCCAATGG - Intergenic
1190327534 X:49215938-49215960 GGAGTGGGGATTCAAGTTGATGG - Intronic
1191967902 X:66780573-66780595 GGAGTGCAGAGGCATCATCATGG - Intergenic
1195353992 X:104021080-104021102 GGAGTGCAGATGTCTCTTCATGG - Intergenic
1196886454 X:120250898-120250920 GGAGTGCGGCTTCTTCTTGTTGG + Exonic
1198694514 X:139321180-139321202 GGAGTGCGGGTGCACCGTGCGGG + Intergenic
1199094773 X:143726218-143726240 GGAGTGCGGGTGCATGGTGTGGG - Intergenic
1201148513 Y:11081095-11081117 GCAGAGCTGATGCTTCTTGAGGG + Intergenic
1202272549 Y:23085631-23085653 GGAGTGTGGGTGCATGGTGAGGG - Intergenic
1202293477 Y:23335051-23335073 GGAGTGTGGGTGCATGGTGAGGG + Intergenic
1202425546 Y:24719375-24719397 GGAGTGTGGGTGCATGGTGAGGG - Intergenic
1202445243 Y:24950710-24950732 GGAGTGTGGGTGCATGGTGAGGG + Intergenic