ID: 916651943

View in Genome Browser
Species Human (GRCh38)
Location 1:166840837-166840859
Sequence GCCCCAAGCACTGTTCCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 113}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916651943_916651950 25 Left 916651943 1:166840837-166840859 CCAGCGGGAACAGTGCTTGGGGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 916651950 1:166840885-166840907 CTCCCCCATCATAGGCTTTGGGG 0: 1
1: 0
2: 2
3: 29
4: 317
916651943_916651945 -4 Left 916651943 1:166840837-166840859 CCAGCGGGAACAGTGCTTGGGGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 916651945 1:166840856-166840878 GGGCTAAAGAGGTTTGTATGTGG 0: 1
1: 0
2: 0
3: 4
4: 99
916651943_916651947 23 Left 916651943 1:166840837-166840859 CCAGCGGGAACAGTGCTTGGGGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 916651947 1:166840883-166840905 GCCTCCCCCATCATAGGCTTTGG 0: 1
1: 0
2: 4
3: 12
4: 146
916651943_916651949 24 Left 916651943 1:166840837-166840859 CCAGCGGGAACAGTGCTTGGGGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 916651949 1:166840884-166840906 CCTCCCCCATCATAGGCTTTGGG 0: 1
1: 0
2: 5
3: 8
4: 141
916651943_916651946 17 Left 916651943 1:166840837-166840859 CCAGCGGGAACAGTGCTTGGGGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 916651946 1:166840877-166840899 GGCTCAGCCTCCCCCATCATAGG 0: 1
1: 0
2: 2
3: 23
4: 480
916651943_916651953 28 Left 916651943 1:166840837-166840859 CCAGCGGGAACAGTGCTTGGGGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 916651953 1:166840888-166840910 CCCCATCATAGGCTTTGGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916651943 Original CRISPR GCCCCAAGCACTGTTCCCGC TGG (reversed) Intronic
900933985 1:5753901-5753923 GCCCCGAGCACCCTTGCCGCTGG + Intergenic
901034277 1:6327041-6327063 GCCCCACGCACAGTGCCCTCTGG + Intronic
902769076 1:18635219-18635241 GACCGAAGCACTGTGCCCTCAGG + Exonic
904440154 1:30524841-30524863 GCCCCAGCCACTGTTCCTCCTGG - Intergenic
906960796 1:50418605-50418627 AACCCCAGCCCTGTTCCCGCGGG - Exonic
914460407 1:147878304-147878326 GCCCCTAGCTCTTTTCCCCCCGG - Intergenic
916651943 1:166840837-166840859 GCCCCAAGCACTGTTCCCGCTGG - Intronic
916808246 1:168280983-168281005 TCCCCAAGCACTGTTCAAGTGGG + Intergenic
918047862 1:180952233-180952255 GCCCCAAGCACTTGTTCCTCTGG - Intergenic
921128060 1:212195658-212195680 GCCCCCAGCAGAGTTCCCACTGG + Intergenic
922665380 1:227464608-227464630 GCCCCAAGCAGTATTGCTGCAGG + Intergenic
1065785240 10:29206945-29206967 GCCTCAAGCTCTGATCCTGCAGG + Intergenic
1069742411 10:70693365-70693387 ACCCCCAGCACTGATCCTGCGGG + Intronic
1073803064 10:107064982-107065004 CCCCCAAGCACTGTTTCCCTGGG + Intronic
1077024888 11:434719-434741 GCCCCGTGCACTGTGCCTGCGGG - Intronic
1084323430 11:68385930-68385952 GCCCCAACCACAAGTCCCGCCGG - Intronic
1085277459 11:75309248-75309270 GGCCCAAGCCCTGCTCCCTCAGG + Intronic
1085395454 11:76204992-76205014 GTACCCAGCACTGTTCCAGCTGG - Intronic
1089467171 11:118692794-118692816 ACCCCATGCCCTGTTCCCACGGG - Intergenic
1092564215 12:9648006-9648028 GCCCCAAGCAAATCTCCCGCGGG + Intergenic
1097031301 12:56091975-56091997 GGCCCAAGCAATTTTCCCACTGG - Intronic
1100010280 12:89944601-89944623 GCCTTAGGCACTGTTCCTGCTGG + Intergenic
1101093569 12:101313020-101313042 GCCCCAAGCAGTGTTGCTGTTGG - Intronic
1101440547 12:104701453-104701475 ACCCCACGCAGTGTGCCCGCCGG - Intronic
1102584257 12:113912145-113912167 GCCCCAGGCACTGCTGCCTCGGG + Intronic
1102924513 12:116816394-116816416 GCCCCAAGGACTCTGCCAGCTGG + Intronic
1105220633 13:18322967-18322989 GCCCCCAGGGCTGTGCCCGCTGG + Intergenic
1106563082 13:30863335-30863357 GCCCCAATCACTCCTTCCGCAGG + Intergenic
1110711207 13:78652944-78652966 GCCCCAAGAACTGCCCCCTCAGG - Intronic
1110853514 13:80272198-80272220 TCCCTAAGCACTGTTTTCGCTGG + Intergenic
1111463404 13:88575914-88575936 GCCCCAAACAGAGTTCCCACTGG - Intergenic
1115309772 14:31967300-31967322 GCCCCAAGCACTGTTTTGGGAGG - Intergenic
1121312016 14:92940470-92940492 GCCCCAAGCACTGAGCCAGCAGG - Exonic
1122258455 14:100498216-100498238 GCACCAAGCAGTCTTCCCTCAGG - Intronic
1122981221 14:105193164-105193186 GCCCCCAGCCCTGCTCCTGCCGG + Intergenic
1125508428 15:40280589-40280611 GGCCCAAGCCCTATTTCCGCTGG - Intronic
1125930165 15:43594362-43594384 GCCTCAGGCACTGTTACCTCGGG - Exonic
1125943333 15:43694194-43694216 GCCTCAGGCACTGTTACCTCGGG - Exonic
1132850526 16:2023018-2023040 GCTCAAAGCTCTGTTCTCGCGGG + Intergenic
1133338335 16:5020938-5020960 GCCCCAAGAACTGATCCCAGAGG - Intergenic
1134243089 16:12520175-12520197 GCCCCAGGCACTTTTCCCTCAGG - Intronic
1136412284 16:30084536-30084558 GCCCCATGCTCTGGTCCCACGGG + Intronic
1137399291 16:48140436-48140458 TCCCTGAGCCCTGTTCCCGCTGG + Intronic
1137695783 16:50461132-50461154 GCCCGAGGCTCTTTTCCCGCAGG + Intergenic
1141954260 16:87359735-87359757 GCCCCAGGCTGTCTTCCCGCGGG - Intronic
1142207770 16:88792141-88792163 GCCCCCAGCTCAGTACCCGCAGG + Intergenic
1142238857 16:88935996-88936018 GCCCCCTGCCCTGTTCCCGGAGG - Intronic
1142685041 17:1572701-1572723 TCCCCAAGCACTGTTGGCCCTGG + Intronic
1142687835 17:1587927-1587949 TCCCCAAGCACTGTTGGCCCTGG + Intronic
1145939885 17:28737797-28737819 TCCCCATGCACTGTACCTGCAGG + Exonic
1146535446 17:33646869-33646891 TCCCCCAGCACTGTGCCTGCTGG - Intronic
1154203177 18:12314160-12314182 GACCCTAGCTCTGTGCCCGCTGG + Intronic
1156445882 18:37236409-37236431 GCCCCCAACACAGTTCCCACAGG + Intergenic
1157094233 18:44672829-44672851 GCCCCAAGCACTTCTTCAGCAGG - Intergenic
1157299290 18:46467962-46467984 GCCCCAAGGCCTGCTCCCGAGGG + Intergenic
1164866013 19:31605105-31605127 GGCCCAAGGACTGTTCCATCTGG + Intergenic
1166784057 19:45357356-45357378 GCCACAGACACTGTCCCCGCTGG - Exonic
1168589301 19:57619272-57619294 GCCCACTGCACTGTTCCTGCAGG + Intronic
926748750 2:16181585-16181607 GCCCCCAGCATTGTTCCCTTCGG - Intergenic
927256080 2:21042296-21042318 TCCCCCAGCCCTGTTCCAGCGGG - Intronic
929532858 2:42763402-42763424 GCACCAGGCACTGTACCTGCTGG - Exonic
931762563 2:65431141-65431163 GCCCCGAGCATTGTTCCCCTCGG + Intronic
936513208 2:113165012-113165034 GCCCCATGCTCTGTTCCTGATGG - Intronic
936517621 2:113192431-113192453 GCCCCAAGCACAGTCCCCAGAGG + Exonic
939291050 2:140195223-140195245 TCCCCAAGAACAGTTCCAGCTGG + Intergenic
939962245 2:148575596-148575618 GCCCCAGACACAGTTCCTGCTGG + Intergenic
940736058 2:157453760-157453782 GCCCAAAACACTGTTCCCCTTGG + Intronic
945194472 2:207225444-207225466 GCCCCAAGCACTGGTCACTGTGG - Intergenic
948194529 2:236085526-236085548 GCAACAAACACTGTTCCAGCTGG + Intronic
1172873806 20:38152202-38152224 GCCCCAGGCACAGTGCCTGCCGG + Intronic
1174167118 20:48592872-48592894 GCCCTAAGCACTGCTCCCTCTGG - Intergenic
1175284462 20:57828778-57828800 GCCCCCAGCACTGTCCCTGGTGG - Intergenic
1175782110 20:61689438-61689460 TCACCAACCACTGTCCCCGCCGG - Intronic
1175782141 20:61689582-61689604 TCACCAACCACTGTCCCCGCCGG - Intronic
1175784998 20:61706737-61706759 TTCCCAACCACTGTTCCCACTGG - Intronic
1176125560 20:63473059-63473081 GCCCAGAGCTCTGGTCCCGCGGG - Intergenic
1176307253 21:5130246-5130268 GCCCACAGCACTGTACCTGCAGG - Intergenic
1179849806 21:44131784-44131806 GCCCACAGCACTGTACCTGCAGG + Intergenic
1180149713 21:45941271-45941293 GCCCCAAGCACGGGTCCCAGTGG - Intronic
1182112703 22:27734620-27734642 GGCCCCAGCACTGTCCCCTCGGG + Intergenic
1185273140 22:49937733-49937755 GCCCCAAGCACTGCTGCCTCGGG + Intergenic
964358332 3:155870484-155870506 GCCCCCAGCCCGGTCCCCGCCGG - Intergenic
967922612 3:194624110-194624132 GTCCCGCGCACAGTTCCCGCTGG - Intronic
969417302 4:7068993-7069015 CCCCCAAGCGGGGTTCCCGCAGG + Intergenic
969600399 4:8172664-8172686 GTCCCAAGCAGTGTACCCACGGG + Intergenic
971689825 4:29818885-29818907 ACCCCAGGCACTGTCCCTGCTGG + Intergenic
973651346 4:53000052-53000074 GCCCCAGGCACTGTGCCTGAGGG - Intronic
979356542 4:119712408-119712430 GCCCCACACACAGTTCCCCCTGG + Intergenic
985626218 5:989937-989959 GCTCAAAGCACTTTTCCTGCAGG + Intergenic
985725302 5:1512982-1513004 ACCCCACGCCCTTTTCCCGCAGG - Intronic
986129055 5:4910284-4910306 GCCCCATGCACAGTCCCCACTGG - Intergenic
988532336 5:32038677-32038699 GCCCTCAGCACTGTGCCTGCTGG + Intronic
989229829 5:39073949-39073971 GCCCCGGGCTCGGTTCCCGCGGG + Intronic
989837188 5:46007535-46007557 GCACCAAGCCCTCTTCCAGCAGG - Intergenic
993292477 5:86092411-86092433 GTCCCTAACACTGTTCCCCCAGG - Intergenic
998182923 5:139957841-139957863 GCCCCAAGCACTGGTCTCTGAGG + Intronic
1002695728 5:181087062-181087084 GCCCTTAGCACTGATCCCCCAGG - Intergenic
1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG + Exonic
1012367082 6:98454722-98454744 GCTACAAGCATTGTTCCCCCTGG - Intergenic
1015818053 6:137230596-137230618 GCTTTAAGCCCTGTTCCCGCTGG - Intergenic
1017005340 6:150025037-150025059 GACCCCAGCTCTGTTCCCGGGGG + Intronic
1018090823 6:160346276-160346298 GCACCAAGCACTGTTCCAGAAGG + Intergenic
1018913264 6:168116557-168116579 TCCCCAAGCACTGTGCTCCCTGG + Intergenic
1029364355 7:100107484-100107506 CCCCCCAGCACTGCTCCCTCTGG - Exonic
1033839149 7:145352928-145352950 GCCCCAAGTGCTTTTCCCCCAGG + Intergenic
1034561552 7:151882997-151883019 TCCCAAAGCAGTGTTCCTGCTGG - Intergenic
1037639578 8:20730526-20730548 GACCCAGGCACTGTTCCCATTGG - Intergenic
1040308361 8:46223857-46223879 GCCCCCAGGACTGTTCCAGGAGG + Intergenic
1040338267 8:46427122-46427144 GCCCCAAGGGCTGTTCCAGGCGG + Intergenic
1044300147 8:90574157-90574179 GCACCAAGCACTGTGGCAGCAGG - Intergenic
1047240487 8:123083237-123083259 GCGCCAAGCACTGTTGACGCAGG + Intronic
1048335133 8:133496992-133497014 GCCCCATGAACTGCTCCCCCAGG + Intronic
1049050669 8:140192463-140192485 GCCCCAGGCACTGTGCCAGGAGG - Intronic
1049435213 8:142583368-142583390 GCCCCAAGCACCCTCCCTGCTGG + Intergenic
1049582686 8:143420056-143420078 GAGCCAAGCTCTGTTCCCCCAGG + Intronic
1057573216 9:96219424-96219446 GCCCCAGGCACGGCCCCCGCAGG - Intergenic
1060913630 9:127370521-127370543 GACACAAGCACTGTGCCAGCTGG - Intronic
1062391261 9:136334840-136334862 GCCCCACTCACTGCTCCAGCAGG - Intronic
1188118638 X:26277598-26277620 GCCCCAAGCACTTTAGCCTCTGG + Intergenic
1199023179 X:142906539-142906561 GTCCCAAGCTGTGTTCCCTCTGG - Intergenic
1199671093 X:150148916-150148938 GCCCCAAACAGTGTTCCTGCTGG + Intergenic