ID: 916653610

View in Genome Browser
Species Human (GRCh38)
Location 1:166852927-166852949
Sequence CAATTTATTCAACACCAACG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916653606_916653610 20 Left 916653606 1:166852884-166852906 CCTGTAAATATGAAAGAACAAAG 0: 1
1: 0
2: 6
3: 38
4: 473
Right 916653610 1:166852927-166852949 CAATTTATTCAACACCAACGAGG 0: 1
1: 0
2: 1
3: 7
4: 110
916653609_916653610 -10 Left 916653609 1:166852914-166852936 CCTGGAGAAAAGACAATTTATTC 0: 1
1: 0
2: 2
3: 45
4: 315
Right 916653610 1:166852927-166852949 CAATTTATTCAACACCAACGAGG 0: 1
1: 0
2: 1
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916653610 Original CRISPR CAATTTATTCAACACCAACG AGG Exonic
900877893 1:5358792-5358814 TAATTTATTCATCACCAAGGAGG - Intergenic
905780157 1:40701857-40701879 CTAGTTATTCAACTCCATCGAGG - Intronic
908916050 1:69127741-69127763 TAATTTATTCAACCCAAACCTGG - Intergenic
910633395 1:89380661-89380683 CAATATATTCAACACACATGAGG - Intronic
914334274 1:146700715-146700737 CAATTTCTTCAATAACAAAGCGG - Intergenic
915736237 1:158087382-158087404 CAATTTATTACACACCTACCAGG - Intronic
916653610 1:166852927-166852949 CAATTTATTCAACACCAACGAGG + Exonic
917678843 1:177345707-177345729 CAATTTATTTAACACTGATGTGG - Intergenic
919415642 1:197305289-197305311 CCATGTACTCAACACCAACAAGG - Intronic
921686585 1:218095769-218095791 CAAATTAATCAAAACCAAAGAGG + Intergenic
1064220949 10:13439978-13440000 CATTTTACTGAACACCAACTGGG - Intronic
1064709064 10:18104601-18104623 CCATTTATTCAACACTTATGGGG + Intergenic
1075905219 10:126075381-126075403 GTATTTATTCAACACCGACTAGG + Intronic
1078982934 11:16559015-16559037 CAATTTTTTCAACATTAAAGAGG + Intronic
1083239657 11:61378112-61378134 CAAATTATTCAACATCAGCTGGG - Intergenic
1086295064 11:85357065-85357087 CAATTTATTGAGCACCTACTTGG - Intronic
1092661359 12:10741708-10741730 CTATTTATTCAACACAACAGAGG - Intergenic
1092977203 12:13756849-13756871 CAATCTATTAAATACCAACTTGG + Intronic
1093788862 12:23223476-23223498 AAATTTACTCAACATCAACAAGG - Intergenic
1093966166 12:25329058-25329080 ATATTTATTCAACAACAACAAGG - Intergenic
1099350774 12:81566047-81566069 CAATGTATTCAAAACCACCCTGG + Intronic
1099571060 12:84319405-84319427 TAATTTATTCAGCACCTACTGGG + Intergenic
1110292129 13:73819533-73819555 ATATTTATTGAACACCTACGAGG + Intronic
1119179372 14:72594711-72594733 CAATTAATTCAACACAACTGAGG - Intergenic
1121737584 14:96229130-96229152 CCATTTATTAAACACCTACTAGG + Intronic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1130074338 15:80675809-80675831 CAAATTATTCAAAACCAAGGAGG + Intergenic
1133576971 16:7101219-7101241 GAATTTATTCTGCACCAGCGTGG + Intronic
1134867232 16:17619419-17619441 CAAATGAATCAACACCAACAGGG + Intergenic
1135325179 16:21521166-21521188 CAATTTAATCAACAGAACCGGGG + Intergenic
1136336663 16:29614434-29614456 CAATTTAATCAACAGAACCGGGG + Intergenic
1139274839 16:65717951-65717973 CAATTTATTCATCTTCAACATGG - Intergenic
1139999343 16:71010517-71010539 CAATTTCTTCAATAACAAAGCGG + Intronic
1141839185 16:86563657-86563679 CAATTTGTTCAACAACTCCGGGG + Intergenic
1142037391 16:87870218-87870240 CAATTTAATCAACAGAACCGGGG + Intergenic
1142431865 16:90032994-90033016 CTGTTTATTCAACAGCAACTGGG + Intronic
1148592825 17:48829572-48829594 GAATTTATTCAGGACCAAAGGGG + Intergenic
1157927511 18:51782378-51782400 CAAATTATTGAACACCAGTGTGG + Intergenic
1162191203 19:8948408-8948430 CACTTTATTCCACACCATCTGGG - Exonic
1162600239 19:11663330-11663352 CAATTTATCAAACACCACAGCGG - Intergenic
926007574 2:9384566-9384588 CAAATTATTCAAACCCAAAGAGG - Intronic
926025217 2:9537193-9537215 CCATTTATTGAACACCTACTTGG + Intronic
927469918 2:23366010-23366032 TAATTTATTTAACAGCAACTTGG + Intergenic
936117257 2:109712067-109712089 CAATTTGTTCAAAACCAAAATGG - Intergenic
941320365 2:164047006-164047028 CAAATTATTGAACACAAAGGTGG + Intergenic
943203023 2:184854279-184854301 CAATTTATTCAACATCCCCCAGG + Intronic
945430117 2:209754328-209754350 CAAATTATTCAAACCCAAGGTGG + Intergenic
1170779770 20:19414072-19414094 CATTTTGTTCAAAACCAAGGAGG - Intronic
1171099895 20:22373216-22373238 CAATTTCTTCAACACCAAAGTGG + Intergenic
1173541013 20:43851322-43851344 CACTTTATTCAACAAAAATGAGG + Intergenic
1173746623 20:45442385-45442407 CAAATTCTCCAACACCAACTAGG - Intergenic
1173907655 20:46640619-46640641 CAATTTATTCATCTGCAAAGTGG - Intronic
1175562564 20:59943108-59943130 CAATTTATTTACCAAGAACGTGG - Intronic
1175742416 20:61429496-61429518 CCATTTATTCAACACACACCAGG - Intronic
1177482562 21:21709721-21709743 CAATTTATTCAACAAATAAGTGG + Intergenic
1183174241 22:36211149-36211171 CAATTAATCCACCACCAACAGGG + Intergenic
950861818 3:16154414-16154436 CAATTTTTTCCCCACCACCGAGG - Intergenic
952266910 3:31795637-31795659 AACCTCATTCAACACCAACGAGG + Intronic
955386698 3:58486523-58486545 CAGTTTATTCATCAGCAACTTGG - Intergenic
959411042 3:106021804-106021826 TAATATATTAAACACCAACTGGG + Intergenic
964775140 3:160267347-160267369 CATTTTATTCTACACCAAGAAGG + Intronic
965407735 3:168291529-168291551 CAATTTATTCAGTACCTATGTGG + Intergenic
965983562 3:174723384-174723406 CAATTTATTGAACACCAAGTAGG - Intronic
967360438 3:188624391-188624413 CCATTTATTCAAAACAAACACGG + Intronic
967466265 3:189809512-189809534 CAACTTAATCAAGACCAAAGTGG + Intronic
968861822 4:3178002-3178024 CAATTTCTTCAAGAGCAAAGAGG + Intronic
971169763 4:24221264-24221286 CAATTTATTGAACACTTACCAGG + Intergenic
972699127 4:41476873-41476895 CAATTCACTCAACACCAAAGGGG - Intronic
973095469 4:46192802-46192824 CTATTTATTCAGCACCAAATGGG + Intergenic
974844120 4:67330514-67330536 CAATTTATTTATCACCACCCTGG - Intergenic
975790828 4:77948567-77948589 GCATTTATTCAACACCCACTTGG - Intronic
977391838 4:96419852-96419874 AAAGTTATTAAACACCATCGTGG + Intergenic
977923799 4:102675506-102675528 GAATTTATTGAACAACAATGAGG - Intronic
978702760 4:111668908-111668930 GAATTTATTCAACACAATCTAGG - Intergenic
978789179 4:112643030-112643052 CAATTCATTCAACAAAATCGAGG + Intronic
989540043 5:42607434-42607456 CAATTTCTTAAACATCAACTAGG + Intronic
990268412 5:54105837-54105859 CAATTTATTAAAAACAAATGAGG - Intronic
991640437 5:68746396-68746418 GAAGTTAGTCAACTCCAACGGGG - Intergenic
991936545 5:71807640-71807662 CAAACTATTCAACAGCAAAGTGG - Intergenic
992232910 5:74681176-74681198 CAACTTATTCACCAACAACAAGG - Intronic
992422264 5:76618301-76618323 CACTGTATTCTACACCAACCTGG - Exonic
996444438 5:123528938-123528960 CACTTTATTCAACGTCAACTGGG - Intronic
997808036 5:136939027-136939049 CAATATATCCAAAGCCAACGGGG + Intergenic
998439151 5:142141818-142141840 CAATTTATTAAACACCTGCCAGG - Intronic
999131472 5:149286787-149286809 CAATTTCCTCAACATCAAAGTGG - Intronic
1004797875 6:19109322-19109344 CAATTTTCTCAACACCATTGAGG + Intergenic
1004976090 6:20968366-20968388 CCAGTTATTCAAGACCAACCTGG - Intronic
1006408652 6:33859486-33859508 ACATTTAGCCAACACCAACGAGG + Intergenic
1007253653 6:40513542-40513564 CAATTTTTTGAACACCTACTAGG + Intronic
1007296136 6:40822517-40822539 CACTTTATTAAATACCAACTAGG - Intergenic
1009990534 6:70837871-70837893 CAATTTATTCAATAACAACTAGG - Intronic
1010170787 6:72972729-72972751 CAATTTATTGAACACCTACTAGG - Intronic
1012641815 6:101627040-101627062 CAATTTATTCAAAAACAATATGG + Intronic
1012767614 6:103388188-103388210 CAAATTATTCAAACCCAAAGAGG + Intergenic
1014370058 6:120595045-120595067 CAGTTTATTCATGAACAACGTGG + Intergenic
1014497349 6:122142343-122142365 CAAATTATTCTCCACCAAAGTGG - Intergenic
1018365433 6:163115692-163115714 TAATTTATTCAAATCCAACCAGG + Intronic
1021991003 7:26141636-26141658 CCACTTATTCAACACCTACTGGG - Intergenic
1025745308 7:64237603-64237625 CCAACTATTCAACACCAACTGGG + Intronic
1028684618 7:93577313-93577335 ATATTTATTGAACACCAAAGGGG + Intergenic
1029795643 7:102891536-102891558 CAATTCATTCAACAACTACTTGG - Intronic
1031265801 7:119578560-119578582 CAACTTATTCCAAACCAAGGTGG - Intergenic
1042293213 8:67191607-67191629 AAAATTATTCAACACTAAAGAGG - Intronic
1042494849 8:69444551-69444573 CAATTTGTTGAAAACCAACTGGG + Intergenic
1044330680 8:90916667-90916689 CATCTTATTCCACACCAACCTGG + Intronic
1044491693 8:92826249-92826271 AACTTTATTTAACACCAATGGGG - Intergenic
1045332946 8:101171997-101172019 CAATTTTTTCATCACCAAAATGG + Intergenic
1047884355 8:129232214-129232236 CAATATTTTCAATACCAAAGAGG - Intergenic
1047903690 8:129450336-129450358 CAATTTCTTCATCAACAATGAGG - Intergenic
1050815339 9:9804585-9804607 AAATTTATTCAACACCTACTAGG - Intronic
1050981638 9:12024499-12024521 CAATTTATACAAAACCAAGCTGG + Intergenic
1051004893 9:12331925-12331947 CAATGTAATCCACACCAACAGGG + Intergenic
1052962294 9:34309162-34309184 CACTTTATTTAACACCATCAAGG - Intronic
1053317043 9:37060681-37060703 CAAAGTGTTCAACACCATCGAGG - Intergenic
1053439445 9:38104165-38104187 CAAGTTGTTTAAGACCAACGGGG - Intergenic
1060946547 9:127572710-127572732 CAATTTATTCAACTCTAAAATGG - Intronic
1061622303 9:131818613-131818635 CAAATTATTGAACACGAAAGGGG + Intergenic
1186499550 X:10040400-10040422 CAAATTAATCAAAACCAAGGAGG - Intronic
1195934210 X:110109634-110109656 CAAATTATTCAAGGCCAATGTGG - Intronic