ID: 916655688

View in Genome Browser
Species Human (GRCh38)
Location 1:166873505-166873527
Sequence GTATGTTTTGCCTACCACCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916655683_916655688 -2 Left 916655683 1:166873484-166873506 CCAGCCTCCGTGCATAACCCTGT 0: 1
1: 0
2: 0
3: 12
4: 145
Right 916655688 1:166873505-166873527 GTATGTTTTGCCTACCACCGAGG 0: 1
1: 0
2: 1
3: 6
4: 63
916655685_916655688 -9 Left 916655685 1:166873491-166873513 CCGTGCATAACCCTGTATGTTTT 0: 1
1: 0
2: 0
3: 23
4: 202
Right 916655688 1:166873505-166873527 GTATGTTTTGCCTACCACCGAGG 0: 1
1: 0
2: 1
3: 6
4: 63
916655684_916655688 -6 Left 916655684 1:166873488-166873510 CCTCCGTGCATAACCCTGTATGT 0: 1
1: 0
2: 0
3: 7
4: 86
Right 916655688 1:166873505-166873527 GTATGTTTTGCCTACCACCGAGG 0: 1
1: 0
2: 1
3: 6
4: 63
916655682_916655688 27 Left 916655682 1:166873455-166873477 CCACTGGATAAATAGCAAATAAC 0: 1
1: 0
2: 3
3: 23
4: 362
Right 916655688 1:166873505-166873527 GTATGTTTTGCCTACCACCGAGG 0: 1
1: 0
2: 1
3: 6
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916655688 Original CRISPR GTATGTTTTGCCTACCACCG AGG Intronic
902595994 1:17509820-17509842 GTGGGCTTTGCCTACCAACGAGG + Intergenic
904282463 1:29430450-29430472 GTCTGTTTTGTCCACCACTGAGG + Intergenic
905884740 1:41485549-41485571 GGATGTCTTGGCTTCCACCGGGG + Intergenic
912553274 1:110498144-110498166 GCATGTTTTGCTCACCATCGTGG - Intergenic
914703915 1:150156207-150156229 GTATGTTTCTCCTGCCACCTTGG + Intronic
915498668 1:156299314-156299336 GGATGTCTTGCTTACCACCCAGG - Intergenic
915610056 1:156984608-156984630 ATAGGTTTTGCCAACCACCAAGG - Intronic
916655688 1:166873505-166873527 GTATGTTTTGCCTACCACCGAGG + Intronic
1063359668 10:5441288-5441310 GTATCTCTTGCCTTCCACCCTGG - Intronic
1068065259 10:52122142-52122164 CTATGTTTTGCCTTCCACCATGG - Intronic
1069229775 10:65995527-65995549 GCATGCTTGGCCCACCACCGAGG - Intronic
1072855779 10:98944604-98944626 GTATGTTATGCCTAGAACAGAGG - Intronic
1074425069 10:113343485-113343507 CATTGTTTGGCCTACCACCGTGG - Intergenic
1090633915 11:128676435-128676457 GTGTCTTTTGCCTTCCACCATGG + Intergenic
1090766876 11:129883953-129883975 GTATGTCCTCCCTACCACTGTGG - Intronic
1093861115 12:24168769-24168791 GTAAGATTTTCCTCCCACCGTGG - Intergenic
1118237882 14:64026790-64026812 GTATGTTTTGTCTGCCCCCTGGG + Intronic
1118446019 14:65851857-65851879 GAATGTTTTGCCTGGCACAGTGG - Intergenic
1126374134 15:47977529-47977551 GTATGTTTTGCCTGTCTCCCTGG - Intergenic
1133882517 16:9796401-9796423 AAATGTTTTGCCTATCACAGGGG - Intronic
1134750623 16:16622124-16622146 ATATGTTGTGCCTACCACATTGG + Intergenic
1134994831 16:18731462-18731484 ATATGTTGTGCCTACCACATTGG - Intergenic
1137906843 16:52332001-52332023 GTATGCTCTGCCTTCCACCATGG - Intergenic
1140465501 16:75178489-75178511 GTATTTTTTTCCTACCACAGTGG + Intergenic
1144083735 17:11787873-11787895 GTGCCTTTTGCCTCCCACCGTGG + Intronic
1152236502 17:79141803-79141825 GTCTGTTTTGCTTGCGACCGGGG - Intronic
1160407916 18:78655434-78655456 GTGTGTTTTGGGTGCCACCGTGG + Intergenic
1160693717 19:472463-472485 GTATGTCCTGCCGTCCACCGTGG - Exonic
1161989024 19:7673458-7673480 GGATATCTTGCCTACCACAGGGG - Intergenic
1166285355 19:41822868-41822890 GTATATTTTTCTTACCACAGGGG - Intergenic
927300584 2:21507996-21508018 AAATGTTTTGCCTGCCACAGAGG + Intergenic
1169186795 20:3624778-3624800 GTATGTTCTGGCTTCCAGCGGGG + Intronic
1174215827 20:48915472-48915494 GGATGTTTTGCCTGCAACTGTGG + Intergenic
1174776905 20:53351770-53351792 GTCTGTTTTTGCTACCACCTGGG - Intronic
949441513 3:4086125-4086147 GTATATTTTGCCTAACAGCCAGG - Intronic
953095301 3:39769010-39769032 GTATGTTATTCCTACCACAGAGG + Intergenic
957642815 3:82880168-82880190 GTTACTTTTGGCTACCACCGTGG + Intergenic
959291858 3:104485052-104485074 GGATTTTTTTCCTACCACAGTGG + Intergenic
965837222 3:172865932-172865954 GTATGTGTTGCCTGTCACCCTGG + Intergenic
968878390 4:3286156-3286178 GTCTGTTTTGCCTAGGACCGAGG + Intergenic
971010474 4:22429457-22429479 GTATGTTTTGACTTCCACACAGG + Intronic
971328166 4:25661343-25661365 GCGTGTTTTACCTACCACCCAGG - Intronic
972709651 4:41582251-41582273 GTATGTTGTTCCTACCACCGTGG + Intronic
976823572 4:89234498-89234520 TCAGGTTTTGCCTACCACAGTGG + Intergenic
985907221 5:2849169-2849191 GTATGTCTTGCCTATCACATTGG - Intergenic
990182653 5:53179687-53179709 ATTTGTTTTTTCTACCACCGTGG + Intergenic
993847593 5:92964089-92964111 GTGTGTTTTTCCTACCCCAGGGG - Intergenic
995055929 5:107758637-107758659 GGATGTTTTTCATACCACCATGG + Intergenic
1007950791 6:45870382-45870404 GTATGTTTTGCTTATTACAGTGG - Intergenic
1010452440 6:76018028-76018050 GTAGGTTTTGCCAACCGCGGTGG - Intronic
1011180636 6:84616115-84616137 GCATGTGTTACCCACCACCGTGG + Intergenic
1020110191 7:5443479-5443501 GGAAGTGTTGCCTACCACCGAGG + Intronic
1022711931 7:32859372-32859394 CTATGTATTCCCTACCACTGAGG + Intergenic
1022912584 7:34914070-34914092 CTATGTATTCCCTACCACTGAGG - Intergenic
1031796323 7:126178750-126178772 GTATGTGTTTGCTACTACCGGGG + Intergenic
1036285286 8:7439262-7439284 GTATGTTTTACCAACCACAATGG - Intergenic
1036336190 8:7872267-7872289 GTATGTTTTACCAACCACAATGG + Intergenic
1036422633 8:8612692-8612714 GTATGTCTTGCCTTCCTCCCAGG + Intergenic
1037315816 8:17598468-17598490 GTATGTTTTGGCTTCCACAGGGG + Intronic
1040659466 8:49553765-49553787 GTATGTTTTGCCATACACAGAGG + Intronic
1043264767 8:78250706-78250728 GTGTGTTTTGCCTACCTTCAAGG + Intergenic
1048037788 8:130693648-130693670 GAATGTTTTGCCATCCACCCAGG - Intergenic
1055262439 9:74453284-74453306 GCATGTATTGCCTAACAACGAGG - Intergenic
1055403920 9:75954380-75954402 GTATGCTTTCCCTCCCACCCAGG - Intronic
1056021534 9:82443020-82443042 GTGTCTTTTGCCTCCCACCATGG - Intergenic
1056801476 9:89695111-89695133 GTATGTTCTCCCTGCCCCCGCGG + Intergenic
1187941996 X:24391598-24391620 GTATGTTTTTCCTGCCCGCGTGG - Intergenic
1188725805 X:33580460-33580482 CTATGGCTTGCCTACCACTGAGG + Intergenic
1192924278 X:75739189-75739211 GAATGTTTTGGGGACCACCGTGG + Intergenic
1198066986 X:133107948-133107970 GAATGTCTTGTCTACCATCGTGG + Intergenic
1198619448 X:138490192-138490214 GTATGTTTTCCCCTCCACAGTGG + Intergenic