ID: 916657386

View in Genome Browser
Species Human (GRCh38)
Location 1:166888160-166888182
Sequence ACTGTGTTTCTGCCACTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916657386_916657387 -8 Left 916657386 1:166888160-166888182 CCAGGCAGTGGCAGAAACACAGT No data
Right 916657387 1:166888175-166888197 AACACAGTGCTGTTACAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916657386 Original CRISPR ACTGTGTTTCTGCCACTGCC TGG (reversed) Intergenic
No off target data available for this crispr