ID: 916657387

View in Genome Browser
Species Human (GRCh38)
Location 1:166888175-166888197
Sequence AACACAGTGCTGTTACAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916657386_916657387 -8 Left 916657386 1:166888160-166888182 CCAGGCAGTGGCAGAAACACAGT No data
Right 916657387 1:166888175-166888197 AACACAGTGCTGTTACAGACTGG No data
916657385_916657387 -2 Left 916657385 1:166888154-166888176 CCAGAGCCAGGCAGTGGCAGAAA No data
Right 916657387 1:166888175-166888197 AACACAGTGCTGTTACAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916657387 Original CRISPR AACACAGTGCTGTTACAGAC TGG Intergenic
No off target data available for this crispr