ID: 916658080

View in Genome Browser
Species Human (GRCh38)
Location 1:166895581-166895603
Sequence CTCCTCAGTGAAGATATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916658080_916658085 5 Left 916658080 1:166895581-166895603 CCTGAGATATCTTCACTGAGGAG No data
Right 916658085 1:166895609-166895631 ATCAGGCCTTAATGCTGTAGGGG No data
916658080_916658083 3 Left 916658080 1:166895581-166895603 CCTGAGATATCTTCACTGAGGAG No data
Right 916658083 1:166895607-166895629 AAATCAGGCCTTAATGCTGTAGG No data
916658080_916658084 4 Left 916658080 1:166895581-166895603 CCTGAGATATCTTCACTGAGGAG No data
Right 916658084 1:166895608-166895630 AATCAGGCCTTAATGCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916658080 Original CRISPR CTCCTCAGTGAAGATATCTC AGG (reversed) Intergenic
No off target data available for this crispr