ID: 916659828

View in Genome Browser
Species Human (GRCh38)
Location 1:166912849-166912871
Sequence GCCTGCTAGAAATTACACTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916659828_916659831 10 Left 916659828 1:166912849-166912871 CCCAAGTGTAATTTCTAGCAGGC 0: 1
1: 0
2: 1
3: 11
4: 99
Right 916659831 1:166912882-166912904 GCCCCTCTTGGAAATGAGCTAGG 0: 1
1: 0
2: 0
3: 8
4: 122
916659828_916659830 -2 Left 916659828 1:166912849-166912871 CCCAAGTGTAATTTCTAGCAGGC 0: 1
1: 0
2: 1
3: 11
4: 99
Right 916659830 1:166912870-166912892 GCATATGCTTGTGCCCCTCTTGG 0: 1
1: 0
2: 0
3: 9
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916659828 Original CRISPR GCCTGCTAGAAATTACACTT GGG (reversed) Exonic
902710913 1:18239125-18239147 ATCTGCTGGAAATCACACTTTGG - Intronic
910253347 1:85221253-85221275 GCCTGCCAGAAATCTCCCTTTGG + Intergenic
910860273 1:91736620-91736642 GCCTCAGAGAAGTTACACTTAGG - Intronic
915277349 1:154798519-154798541 TCTTGCCATAAATTACACTTGGG - Intronic
916659828 1:166912849-166912871 GCCTGCTAGAAATTACACTTGGG - Exonic
916958056 1:169860889-169860911 GTGTGCTAGAAAGTTCACTTTGG - Intronic
916991995 1:170254553-170254575 GCCTGCTTGAAATTACACCCAGG - Intergenic
919014500 1:192014599-192014621 GCCTAATAGAAAATACAATTTGG + Intergenic
921413407 1:214861409-214861431 GCCTACTAGAAATTTCACATTGG + Intergenic
924491781 1:244545186-244545208 GACTGCAAGAAATTTCACTGAGG - Intronic
1063106209 10:2994858-2994880 TCATTCTAGAAATTACATTTAGG + Intergenic
1064757058 10:18580791-18580813 TCCTGCTAGCAAGTTCACTTGGG - Intronic
1071957712 10:90777622-90777644 ACCTGCAAGAAATTTCATTTTGG + Intronic
1074235716 10:111582542-111582564 GACTGCTAGAAGTTTCACTGAGG + Intergenic
1087227271 11:95615123-95615145 GGCTGCTAGAAGTTCCACTTCGG + Intergenic
1092882862 12:12901357-12901379 GGCTGCCAAAAATTGCACTTTGG - Intronic
1096043068 12:48537489-48537511 GCCAGCTAGAACTTACATTATGG + Intergenic
1097602670 12:61713777-61713799 GCATGCCAGAATTTAAACTTGGG - Intronic
1098807148 12:75034547-75034569 GACCTCTAGAAATTTCACTTAGG - Intergenic
1099283299 12:80681041-80681063 ACCTGCTAGAAATGACTCTCAGG - Intergenic
1099810315 12:87572663-87572685 TCCTGCTAAAAATTTCACTGGGG - Intergenic
1104226997 12:126844921-126844943 GCCTGCTAAATATATCACTTTGG + Intergenic
1106626583 13:31426875-31426897 GCCAGCTAGATGTTACTCTTTGG + Intergenic
1110032902 13:70639397-70639419 GCTTCCTAGAAATTACTCCTGGG - Intergenic
1111888344 13:94050969-94050991 CCCTGCTAGATAATCCACTTTGG + Intronic
1112098700 13:96163846-96163868 CCCTGCTAGCAACTGCACTTTGG - Intronic
1114659209 14:24334176-24334198 GCCTCCTAGAATTTCCCCTTTGG + Intronic
1118564867 14:67128584-67128606 TACTACTAGAAATAACACTTGGG - Intronic
1118691747 14:68346616-68346638 TTCTGCTAGAAAGAACACTTTGG - Intronic
1130533330 15:84764559-84764581 GCCTGCTTGAATTTACATTTGGG + Intronic
1134085682 16:11356022-11356044 GCCTGCTATAAACTACACAGGGG - Intergenic
1136094530 16:27945590-27945612 GTCTGCTTGAAATTTCATTTTGG - Intronic
1136706586 16:32193954-32193976 GCCTTTTAGAAATTAAATTTTGG + Intergenic
1136761325 16:32735463-32735485 GCCTTTTAGAAATTAAATTTTGG - Intergenic
1136806778 16:33134923-33134945 GCCTTTTAGAAATTAAATTTTGG + Intergenic
1203063477 16_KI270728v1_random:995780-995802 GCCTTTTAGAAATTAAATTTTGG - Intergenic
1155363151 18:25023459-25023481 GTCTGCTATAAATCACAATTAGG - Intergenic
1156686297 18:39651073-39651095 GTGTGGTAGAATTTACACTTGGG - Intergenic
1156712630 18:39965243-39965265 GACTGCAAGAAAAAACACTTAGG - Intergenic
1159681694 18:71361516-71361538 GCCACTTAGAAATTACAATTGGG - Intergenic
1164388007 19:27793535-27793557 GTCTGCGAGAAATCAAACTTTGG + Intergenic
1165636248 19:37342710-37342732 GCCTGTTAAAAGTTTCACTTGGG - Intronic
925217938 2:2113246-2113268 GCATCCTAAAAATTAAACTTTGG + Intronic
934674006 2:96236688-96236710 GCTTGCTAGAAACTCCACCTTGG - Intergenic
939525278 2:143286302-143286324 GTCTGTTAGAAATAACACTCTGG - Intronic
941024420 2:160442821-160442843 GCCTGCTAGAAAGGGCACTAAGG + Intronic
944120198 2:196232226-196232248 GCCTGCTTAAAATTAAACTGTGG + Intronic
946947708 2:224838997-224839019 GCCCCCCAGCAATTACACTTTGG + Intronic
1169644962 20:7800006-7800028 GCCTCCCAGAAATCACATTTGGG + Intergenic
1178851742 21:36218038-36218060 GTCTGCAAGAAATCACACTCAGG + Intronic
1179139431 21:38711330-38711352 GCCTGCTAGACATTATGCTGTGG + Intergenic
1179937965 21:44617006-44617028 CCCTGCTAGAAAACACACATGGG + Intronic
1180253881 21:46609018-46609040 ACCTGCTAGAAACTTCACTGAGG - Intergenic
949616314 3:5757443-5757465 GTCTGCAAGAAATTAAACTTAGG + Intergenic
949658616 3:6251259-6251281 GCCTGCTGGAAATGTCAATTAGG - Intergenic
949905818 3:8857635-8857657 GGATGCTAGAAATTTCACTGAGG - Intronic
952470491 3:33645222-33645244 GCGTGCTAGAAGATACACTATGG - Intronic
957160695 3:76605825-76605847 GCCTGGGAGAAAATACACTTTGG + Intronic
957607432 3:82420106-82420128 TGCTACTAGAAATTACATTTTGG + Intergenic
958642975 3:96832402-96832424 GGATGTTACAAATTACACTTGGG - Intronic
960287888 3:115850178-115850200 TTCTGCTTTAAATTACACTTTGG + Intronic
962375916 3:134858656-134858678 GGCTGCTAAAAATAACACTACGG + Intronic
963832229 3:150020928-150020950 GCTTCCCAGAAATTAAACTTAGG + Intronic
972298324 4:37761489-37761511 GGCTGCTAGAATGTCCACTTAGG - Intergenic
973143629 4:46798170-46798192 GACTCCTAGAAATTTCACTGAGG - Intronic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
974211703 4:58785369-58785391 GCCATCTAAAAATTATACTTTGG + Intergenic
974704150 4:65489574-65489596 ACATGCTAGAAATTACTCTTAGG + Intronic
975384589 4:73741222-73741244 GCCTACTATAAATAACACTGTGG + Intronic
981108309 4:140906156-140906178 GCCTGCTAGAATTTTCATTCAGG + Intronic
989307555 5:39974995-39975017 GACTCCTAGAAATTTTACTTAGG + Intergenic
990284630 5:54288743-54288765 ACCTACTACAAATAACACTTTGG + Intronic
993824938 5:92671773-92671795 GTATGCTAGAAATGACACTTAGG - Intergenic
994720901 5:103379301-103379323 ACATGGTAAAAATTACACTTTGG + Intergenic
996908771 5:128632538-128632560 GACTCCTAGAAATTTCACTGAGG + Intronic
999408914 5:151333097-151333119 GCCTGCTAGAAAATGCCCATGGG - Intronic
1000732513 5:164853890-164853912 TCCTGCTGGACATTAAACTTGGG - Intergenic
1004329883 6:14711666-14711688 GCCTGTTAGAAATTCAACTGAGG + Intergenic
1010110843 6:72228948-72228970 GCATGTTAGAAATTTCAGTTTGG - Intronic
1010712736 6:79194153-79194175 GCCTGCCAAAAATGACAATTTGG - Intergenic
1011457332 6:87566010-87566032 GCCTACTATGTATTACACTTTGG + Intronic
1017597810 6:156048156-156048178 CCCAGCTAGAATGTACACTTTGG + Intergenic
1020873138 7:13658674-13658696 GCCTTCTAGGAAGTTCACTTGGG - Intergenic
1023088599 7:36597072-36597094 CCGTGCTGGAAATCACACTTAGG - Intronic
1023695411 7:42841000-42841022 GCCAGCTACAAAGTAGACTTAGG + Intergenic
1024358174 7:48439448-48439470 GAATGCTAGAAATTAAACTTAGG + Intronic
1026625323 7:71987164-71987186 GCCTGCCAGAATTTTCACCTAGG + Intronic
1028381889 7:90209567-90209589 TCCTGATAGAAGTTACAGTTTGG - Intronic
1031754577 7:125622103-125622125 GCATGCTTGAAATTAGACTAAGG + Intergenic
1032905502 7:136359975-136359997 ACCTACTAGAAATTAATCTTGGG - Intergenic
1033965211 7:146966929-146966951 ACCTCCAAGAAATTACAATTTGG - Intronic
1036286793 8:7449714-7449736 GCCCACTAGAATGTACACTTTGG - Intronic
1036334685 8:7861809-7861831 GCCCACTAGAATGTACACTTTGG + Intronic
1036621732 8:10428445-10428467 GCCTCCTATAGATTATACTTCGG - Exonic
1037237426 8:16737789-16737811 GCCTTCTAGAAATTCTACATAGG + Intergenic
1039078401 8:33712901-33712923 ACCTGCTAGCAGTCACACTTGGG - Intergenic
1041865109 8:62563721-62563743 GCCTGCTAAAAATAACTTTTGGG - Intronic
1044108326 8:88239133-88239155 GCCTGCTTGTAATCACATTTGGG - Intronic
1044674324 8:94714476-94714498 ACCTGCTATTAATTGCACTTAGG - Intergenic
1045051368 8:98329623-98329645 GCCTTCTAGAATTTTCTCTTTGG + Intergenic
1045617587 8:103936655-103936677 GAATGCTAGAGATTACCCTTTGG + Exonic
1050888907 9:10798171-10798193 GGATCCTAGAAATTTCACTTAGG + Intergenic
1054726957 9:68662246-68662268 GCCTATTAGAAATCACACTGGGG + Intergenic
1056058367 9:82853904-82853926 GCCAGCAAGAAATTAGAATTAGG - Intergenic
1058268024 9:102931852-102931874 GACTGATGGAAATTAAACTTTGG - Intergenic
1186575291 X:10759151-10759173 TCTTGCTAGTAATTTCACTTTGG + Intronic
1190255126 X:48756758-48756780 GACTCCTAGAAATTTCACTGAGG - Intergenic
1194683576 X:96883945-96883967 GCTTGCTTGAAATTACACGTGGG + Exonic
1195451550 X:105019585-105019607 GCTTGCTAAAAAATACTCTTGGG + Intronic
1196815250 X:119660383-119660405 GCCTCCTTGAAATTGCACTGAGG - Intronic
1199371667 X:147056892-147056914 GCCTCCTAGAAATTTCACTTGGG + Intergenic
1199499300 X:148492482-148492504 AACTTCTAGAAACTACACTTTGG + Intergenic