ID: 916660110

View in Genome Browser
Species Human (GRCh38)
Location 1:166915726-166915748
Sequence TAGTCCACAAAATTTCACAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 145}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916660110_916660116 20 Left 916660110 1:166915726-166915748 CCTATGTGAAATTTTGTGGACTA 0: 1
1: 0
2: 0
3: 13
4: 145
Right 916660116 1:166915769-166915791 TGGTCAGGTGCCTTGGGTTTGGG 0: 1
1: 0
2: 2
3: 15
4: 231
916660110_916660115 19 Left 916660110 1:166915726-166915748 CCTATGTGAAATTTTGTGGACTA 0: 1
1: 0
2: 0
3: 13
4: 145
Right 916660115 1:166915768-166915790 GTGGTCAGGTGCCTTGGGTTTGG 0: 1
1: 0
2: 4
3: 59
4: 261
916660110_916660117 23 Left 916660110 1:166915726-166915748 CCTATGTGAAATTTTGTGGACTA 0: 1
1: 0
2: 0
3: 13
4: 145
Right 916660117 1:166915772-166915794 TCAGGTGCCTTGGGTTTGGGTGG 0: 1
1: 0
2: 1
3: 24
4: 227
916660110_916660112 5 Left 916660110 1:166915726-166915748 CCTATGTGAAATTTTGTGGACTA 0: 1
1: 0
2: 0
3: 13
4: 145
Right 916660112 1:166915754-166915776 AAATATTTACAGATGTGGTCAGG 0: 1
1: 0
2: 0
3: 22
4: 330
916660110_916660114 14 Left 916660110 1:166915726-166915748 CCTATGTGAAATTTTGTGGACTA 0: 1
1: 0
2: 0
3: 13
4: 145
Right 916660114 1:166915763-166915785 CAGATGTGGTCAGGTGCCTTGGG 0: 1
1: 0
2: 1
3: 20
4: 196
916660110_916660113 13 Left 916660110 1:166915726-166915748 CCTATGTGAAATTTTGTGGACTA 0: 1
1: 0
2: 0
3: 13
4: 145
Right 916660113 1:166915762-166915784 ACAGATGTGGTCAGGTGCCTTGG 0: 1
1: 0
2: 1
3: 25
4: 225
916660110_916660111 0 Left 916660110 1:166915726-166915748 CCTATGTGAAATTTTGTGGACTA 0: 1
1: 0
2: 0
3: 13
4: 145
Right 916660111 1:166915749-166915771 TTCAGAAATATTTACAGATGTGG 0: 1
1: 0
2: 3
3: 49
4: 477

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916660110 Original CRISPR TAGTCCACAAAATTTCACAT AGG (reversed) Exonic
901258336 1:7851462-7851484 TGGTCGACCACATTTCACATAGG - Intronic
904175153 1:28622538-28622560 TAGTCCACAAAATTTAAACAAGG + Intronic
907088028 1:51696345-51696367 TTGCCAACAAAATTTCACAAAGG + Intronic
909537069 1:76749188-76749210 TAGTCCTCATAATTTCTCTTTGG - Intergenic
910072696 1:83238138-83238160 TTTTCTACAAACTTTCACATAGG + Intergenic
911367744 1:96959589-96959611 TACTTCACAGAATTTCACTTAGG - Intergenic
911903664 1:103537672-103537694 TAATCCAAAAATTTTCACTTAGG - Intronic
915455930 1:156040751-156040773 CAGTCCACAGAATTTAACTTGGG + Intronic
916660110 1:166915726-166915748 TAGTCCACAAAATTTCACATAGG - Exonic
918509018 1:185289869-185289891 AAGGACACAAAATTTCAGATAGG + Intronic
918746782 1:188211473-188211495 GAGTGCACACAATTTCACATGGG - Intergenic
919090331 1:192971252-192971274 TAGCCCACAGAATTTGCCATTGG + Intergenic
920591919 1:207228408-207228430 TGGTCCTCAAAATATCACTTTGG + Intergenic
921143163 1:212325287-212325309 TTCTCCACAAAATTTCCCTTAGG - Intronic
921960334 1:221027424-221027446 GAGAACACAAAATTTCCCATGGG + Intergenic
921969392 1:221129974-221129996 TATTTGACAAAATTCCACATCGG - Intergenic
923059859 1:230461639-230461661 TAGTCAACAAATTTTGACAAAGG + Intergenic
923060496 1:230467899-230467921 TAGTATACAAAATTTCCCAATGG - Intergenic
924869683 1:248027636-248027658 CAGCCCCCAATATTTCACATGGG - Intronic
1065263879 10:23955149-23955171 TAGAACACAAAAGTTCACAGAGG + Intronic
1068273776 10:54765151-54765173 TCTTAGACAAAATTTCACATAGG + Intronic
1074955609 10:118385571-118385593 TAGGGCAAAAGATTTCACATCGG - Intergenic
1077939224 11:6822705-6822727 TTATTCACAAAATTTCAAATAGG - Intergenic
1079663663 11:23075294-23075316 TATTCCATAAAACTTCCCATTGG - Intergenic
1080251372 11:30237327-30237349 TAGTCCACCAAATATCTCATGGG - Intergenic
1081061755 11:38487654-38487676 TATTACACAACATTTCACATTGG - Intergenic
1086441215 11:86831443-86831465 TATTACAAAAAATTTCACAGGGG - Intronic
1090582221 11:128172911-128172933 TAGTCCCGCAGATTTCACATAGG + Intergenic
1091203809 11:133803641-133803663 AAACCAACAAAATTTCACATAGG + Intergenic
1093044783 12:14430446-14430468 GAGAGCACAAAAATTCACATAGG + Intronic
1093385297 12:18546003-18546025 GGGTCCACAAATTCTCACATGGG + Intronic
1094801788 12:34045862-34045884 CTGTCCAAAAAATTTCATATTGG + Intergenic
1098487523 12:71039211-71039233 TAGTCCAAAAAATATATCATGGG - Intergenic
1098522143 12:71445068-71445090 TACTTCACAAAATTGCTCATTGG - Intronic
1098612344 12:72475446-72475468 TAGTCAACAGAATTATACATGGG + Intronic
1099625936 12:85073998-85074020 AATACCACAATATTTCACATTGG + Intronic
1100086693 12:90919402-90919424 TAGGCCACAAAATCTCTCCTAGG + Intronic
1101363342 12:104048406-104048428 TAGTTCACAGAGTTTCCCATGGG + Intronic
1106666358 13:31855147-31855169 TAGTCCAATAAATTTCAGATAGG + Intergenic
1106996436 13:35488717-35488739 TAATTTACAAATTTTCACATTGG - Intronic
1109933360 13:69245764-69245786 CTTTCCACAACATTTCACATTGG - Intergenic
1110754661 13:79158291-79158313 AAGGACACAAAATTTCACTTAGG + Intergenic
1111084481 13:83356896-83356918 TAGCTCCCTAAATTTCACATAGG + Intergenic
1111684888 13:91489414-91489436 CAGCCCCCAATATTTCACATAGG - Intronic
1113718259 13:112530086-112530108 TAGGCCACAGAAATACACATAGG + Intronic
1114766387 14:25375712-25375734 AAGTCTACAAAACTTCAAATGGG - Intergenic
1117317105 14:54582195-54582217 TAGTTCACAACATTTTAGATAGG + Intronic
1120657661 14:87213981-87214003 TAATCAACAAAATTTAAGATAGG - Intergenic
1121481855 14:94284369-94284391 TATTCCACAATACTTCACATTGG - Intronic
1126445911 15:48743913-48743935 TAGTAAAGAAAATGTCACATGGG - Intronic
1128129062 15:65213510-65213532 TAGGCCATCAGATTTCACATGGG - Intergenic
1128262023 15:66239300-66239322 TTGTCCACAAAGATTCAGATGGG - Intronic
1130010279 15:80147401-80147423 AAGCCCACAAAATTTCAGATAGG + Intergenic
1131813207 15:96194972-96194994 TAATTGACAAAATTTCACAAAGG - Intergenic
1131989738 15:98081553-98081575 TAGACCCCAAAAGTTCTCATGGG - Intergenic
1132039157 15:98510602-98510624 TTGTACACAAATTTTCACAGTGG + Intronic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1135939773 16:26811151-26811173 AAGGACACAAAATTTCACTTAGG - Intergenic
1136593818 16:31233121-31233143 ATGTCCACAAAATTTTGCATTGG + Intergenic
1145103934 17:20099149-20099171 TAATAAACAAAATTACACATAGG - Intronic
1146840066 17:36145439-36145461 TGGTGAACAATATTTCACATGGG + Intergenic
1148099147 17:45077118-45077140 TACTAAACATAATTTCACATGGG - Intronic
1156597278 18:38561988-38562010 TAGACCATAAAATGTCTCATGGG - Intergenic
1156772490 18:40746310-40746332 TAGTTCACAAGATTAGACATAGG - Intergenic
1156828010 18:41456337-41456359 TAGTACATAAAAGTACACATGGG + Intergenic
1157174032 18:45434399-45434421 TAGTGCACAAAATATAAAATAGG - Intronic
1159306403 18:66648612-66648634 TTGTTAACAAAATTTCACACTGG + Intergenic
1165254805 19:34569639-34569661 TATTCCAATAAATTTCACAGTGG + Intergenic
1165281066 19:34797835-34797857 TAGACCACAAAATCTCAGAAGGG + Intergenic
928708428 2:33977256-33977278 CAGCCCCCAATATTTCACATAGG - Intergenic
931081026 2:58770948-58770970 TAGTTGACAAAATGTCACAAAGG + Intergenic
933437385 2:82264872-82264894 TTGTCCACAAAACTTCACAAAGG + Intergenic
935188861 2:100759566-100759588 TTGTGCACAAAAATTCACTTGGG - Intergenic
935738315 2:106124504-106124526 TACTCCACAAAAGTTTACTTTGG + Intronic
939755172 2:146101213-146101235 TCTTCCACAAGATATCACATGGG + Intergenic
940178204 2:150902766-150902788 TACTCCATCAAATTTCACAATGG + Intergenic
940205914 2:151201588-151201610 AAGTCCACAAAATTCCATATTGG - Intergenic
942701888 2:178720577-178720599 GAGTTCCCGAAATTTCACATTGG + Exonic
943282293 2:185951285-185951307 TATTTTACAAAATTTTACATTGG - Intergenic
945799755 2:214413354-214413376 TTGTCCACATTATTTTACATAGG - Intronic
1169132800 20:3174803-3174825 AAGCACACAAAATTTCTCATGGG - Intergenic
1177753750 21:25319453-25319475 TATTACACAAAATTTCTCAAAGG - Intergenic
1182571148 22:31239129-31239151 TTGGCCAGCAAATTTCACATGGG + Intronic
1182738071 22:32545350-32545372 TATTCCACAAAAATTTACTTAGG - Intronic
950896433 3:16455798-16455820 TAGTCAACATAATTCTACATCGG + Intronic
952095197 3:29943160-29943182 TAGTCCAAAAGTTGTCACATGGG + Intronic
954120241 3:48494076-48494098 AAGGACACAAAATTTCACTTAGG - Intronic
955549039 3:60063409-60063431 TAGTCCATCCAAATTCACATTGG + Intronic
955578845 3:60396998-60397020 TTGTCCACAAAATCACATATAGG + Intronic
956565676 3:70634989-70635011 AAGGACACAAAATTTCACTTAGG + Intergenic
958633036 3:96704933-96704955 TAGTTCTCAGAATTTCACAGTGG + Intergenic
959147100 3:102561092-102561114 TATTTGACAAAATTCCACATAGG - Intergenic
959542944 3:107560774-107560796 TATTCTTCAAAATTTAACATTGG + Intronic
959772261 3:110112430-110112452 TATATCACAGAATTTCACATAGG + Intergenic
960472181 3:118079791-118079813 TATTCAACATCATTTCACATTGG + Intergenic
960833763 3:121881836-121881858 TATTCCAGTAAATTTGACATAGG + Intronic
961293195 3:125864086-125864108 TATGACACCAAATTTCACATGGG - Intergenic
961797637 3:129421258-129421280 TAGTTCACACCATTTCACAGAGG - Intronic
968562734 4:1293516-1293538 TAGTTTAGAGAATTTCACATGGG + Intronic
969539842 4:7781105-7781127 TAATTCACAAAATTTCACTGGGG + Intronic
969930034 4:10621875-10621897 CACTCCACAAATTTTCACAGTGG + Intronic
972230928 4:37072028-37072050 CAGTCCACAAAATGTCACCAGGG + Intergenic
972719942 4:41686064-41686086 TAGCCCACAAATTTAAACATTGG + Intronic
974791303 4:66693615-66693637 CAGTCCATAAACTTTCATATTGG + Intergenic
974798033 4:66779525-66779547 TATTCCACATAATATCACATTGG + Intergenic
976113641 4:81703192-81703214 TAGGCCACAAAATCTCACCAAGG - Intronic
981160856 4:141496966-141496988 TCTTCCACAAAATATCACACTGG + Intergenic
983120647 4:163880093-163880115 TAGTTAATAAAATTTTACATAGG - Intronic
985699866 5:1364320-1364342 TTGTGCACAAAATTTCACAAAGG - Intergenic
987628564 5:20435864-20435886 TAGTTCACAAAAATTGACAGAGG - Intronic
988287965 5:29246019-29246041 AAGTCAACAAAATTTAACAATGG + Intergenic
988469102 5:31520682-31520704 AAGACCACAAAATTTTACTTCGG + Intronic
988881217 5:35505082-35505104 CAGCCCACAAAACTTCATATAGG + Intergenic
990124943 5:52503636-52503658 TAGTGTACAAAATCTCACAGAGG - Intergenic
990660037 5:58002933-58002955 TTGTTCACATAATTTGACATGGG + Intergenic
991324096 5:65410641-65410663 TAGGACACAAAATTTCAATTTGG - Intronic
993834789 5:92805478-92805500 TAGTTCACATAATTATACATGGG + Intergenic
994391914 5:99200240-99200262 TATTCCACACAATATCACAGAGG + Intergenic
997815082 5:137009201-137009223 TTGACCCCAAAATTTCACTTTGG + Intronic
999475345 5:151893029-151893051 TACTTCACAAAATCTCACTTGGG + Intronic
999543076 5:152595822-152595844 TATTCCCCAAAACCTCACATTGG - Intergenic
1001315047 5:170636026-170636048 GAGTCTCCAAAATGTCACATCGG - Intronic
1002517713 5:179772045-179772067 TAATCCACAAAATGTCAGATGGG - Intronic
1003111572 6:3255753-3255775 CATTCCACAGAATATCACATTGG - Intronic
1003692304 6:8366682-8366704 AAGTCCTCACACTTTCACATAGG - Intergenic
1011266205 6:85522027-85522049 TAGTCAACTAAATTTGACAGAGG - Intronic
1012160445 6:95878482-95878504 TATTCCATAAAATTTCAAAAAGG + Intergenic
1012523241 6:100145959-100145981 TATTCTACAAAATTTCTCCTAGG + Intergenic
1013357425 6:109358661-109358683 TAATCCACACAATATCACATTGG + Intergenic
1013703103 6:112797518-112797540 TAATCCATAAAATATCTCATGGG - Intergenic
1015909608 6:138156342-138156364 TTGTCAACATGATTTCACATTGG + Intergenic
1016443970 6:144113685-144113707 CAGTCCACAGAACTTCACTTGGG - Intergenic
1020842595 7:13238671-13238693 TCTTCCACACAATTTCATATAGG - Intergenic
1020918318 7:14227218-14227240 TTGTTCAAAAAATTTCACTTTGG + Intronic
1021441183 7:20678665-20678687 TAGTCCACAAAATCTTTCAGAGG + Intronic
1024727760 7:52219123-52219145 TATTACACAAAATTTCAATTTGG - Intergenic
1026471940 7:70701189-70701211 TGGTCCATAAAATTTCACCGTGG + Intronic
1027290274 7:76700938-76700960 TTTTCTACAAACTTTCACATAGG + Intergenic
1027290419 7:76703293-76703315 TTTTCTACAAACTTTCACATAGG + Intergenic
1030772014 7:113486912-113486934 TAGTGAACAAAATTTCTAATTGG + Intergenic
1031535369 7:122927445-122927467 TAGAGCACAAAATTTCACTCTGG - Intergenic
1032591012 7:133192511-133192533 TAGTCCACAGAATTTTAGTTTGG - Intergenic
1037010714 8:13839082-13839104 TGTTCCACAAAAATTAACATGGG + Intergenic
1037204315 8:16295243-16295265 CAGCCCCCAATATTTCACATGGG - Intronic
1037243966 8:16809646-16809668 TAGTACCTAAAATTTCAAATTGG - Intergenic
1043076379 8:75706613-75706635 TATTCCACAAAACTTCATAGTGG + Intergenic
1044554794 8:93551347-93551369 TAGAGCACAAAATTTCAGATAGG + Intergenic
1044936136 8:97295181-97295203 TCTTCCACAAAATATCACTTTGG - Intergenic
1045825398 8:106391330-106391352 TCATGCCCAAAATTTCACATTGG - Intronic
1047057358 8:121180751-121180773 AAGGACACAAAATTTCACTTAGG + Intergenic
1047231673 8:123002817-123002839 CAGACCACAAAATATTACATTGG + Intergenic
1051400445 9:16675882-16675904 TAAAATACAAAATTTCACATGGG - Intronic
1059666936 9:116455425-116455447 TAGTAAAGAAAATGTCACATGGG - Intronic
1186781299 X:12914873-12914895 TAGGACACAAAATTTCAGTTAGG + Intronic
1188713812 X:33435474-33435496 AAGTCCAATAAATTTCATATAGG + Intergenic
1191769578 X:64740683-64740705 ATTTCCACAAAATATCACATTGG - Intergenic
1194973106 X:100365924-100365946 TTGTCAACTAAATTTCTCATGGG + Intronic
1195508118 X:105682399-105682421 TAGGCCACTAGATTTCAAATAGG - Intronic
1198250941 X:134878636-134878658 AAGGCCAGAAAATTTGACATAGG + Intergenic