ID: 916660583

View in Genome Browser
Species Human (GRCh38)
Location 1:166919884-166919906
Sequence GAGGCAGGGTAATTGCGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916660572_916660583 10 Left 916660572 1:166919851-166919873 CCAGCTTGGATTCATAAAAAACG 0: 1
1: 0
2: 1
3: 3
4: 64
Right 916660583 1:166919884-166919906 GAGGCAGGGTAATTGCGAAGGGG 0: 1
1: 0
2: 1
3: 13
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916660583 Original CRISPR GAGGCAGGGTAATTGCGAAG GGG Intronic
902563363 1:17292894-17292916 GAGGGAGGGGAATGGGGAAGGGG + Intergenic
903444041 1:23409479-23409501 AAGGCAGGGTAAGTGAGATGGGG - Intronic
905126515 1:35719228-35719250 GTGGGAGGGTAACTGCGGAGAGG - Exonic
910758959 1:90717331-90717353 AAGGAAGGGTAATTGGGAAGTGG + Intergenic
915113105 1:153577364-153577386 GAGCCAGGGTGATTGCGGAGCGG - Intergenic
916660583 1:166919884-166919906 GAGGCAGGGTAATTGCGAAGGGG + Intronic
917962714 1:180157182-180157204 GAGCCAGGGTAAATGGGAGGTGG + Intronic
920367361 1:205455229-205455251 GAGGCAGGCTTATGGCCAAGAGG + Intronic
922338204 1:224634756-224634778 GATGCAGGGTAACTGGGCAGGGG - Intronic
923109439 1:230879544-230879566 GAGGCAGGGTGATTGAGGAGGGG - Intergenic
923109482 1:230879664-230879686 GGGGCAGGGTGATTGAGGAGGGG - Intergenic
923109494 1:230879703-230879725 GGGGCAGGGTGATTGTGGAGGGG - Intergenic
923109579 1:230879966-230879988 GACGCAGGGTGATTGAGGAGGGG - Intergenic
923390038 1:233505397-233505419 GAGGCAGGGAAATTGCAACATGG - Intergenic
1067308751 10:45092563-45092585 GAGGCAGAGTAATTGCAAGAAGG + Intergenic
1067841877 10:49687704-49687726 GAGGAAGGCTCATTGCGAAGGGG + Intronic
1069408418 10:68127098-68127120 GAGGCAGGGGAATTGCTTGGAGG - Intronic
1069958753 10:72067563-72067585 GAGGGAGGGAAATAGGGAAGGGG - Intronic
1072043969 10:91636374-91636396 GAGTCAGGGAAGTTGCGAACTGG + Intergenic
1073081025 10:100860830-100860852 GAGGCTGGGTAATTGGGCAGAGG + Intergenic
1075857558 10:125643014-125643036 GAGGCAGTGAATTTGAGAAGGGG + Intronic
1076134469 10:128036070-128036092 GAGGCAGGGATGTTGGGAAGTGG + Intronic
1077694066 11:4377522-4377544 GATGCAGGGTTAGTGCAAAGAGG - Intergenic
1080531717 11:33182695-33182717 CAGGCAGGATAATTGCTCAGAGG + Intergenic
1081360870 11:42176291-42176313 GAGGCAGGGAAAAAGTGAAGAGG - Intergenic
1081779211 11:45698514-45698536 CAGGCAGGGTACCTGCGATGAGG + Intergenic
1082731063 11:56798364-56798386 GAAGCAGGGCATTTGGGAAGTGG - Intergenic
1083930858 11:65844006-65844028 CAGGCATGGTAATTGCGCATGGG - Intronic
1084674410 11:70625721-70625743 GAGGCAGGGGACTTGGGGAGCGG - Intronic
1086113590 11:83223804-83223826 GAGGCAGGGTAATGTCCAAGTGG - Intronic
1086326707 11:85708933-85708955 GAGGCAGGAGAATGGCGAGGAGG - Intronic
1086700660 11:89897282-89897304 GAGTCAGTGTAATTGTGAATGGG - Intergenic
1086705509 11:89947244-89947266 GAGTCAGTGTAATTGTGAATGGG + Intergenic
1089097468 11:115931157-115931179 GAGGGAGGGTGATGGGGAAGGGG + Intergenic
1089964487 11:122644708-122644730 GAGGCAGGGCAATCGCAAGGTGG - Intergenic
1090500769 11:127258432-127258454 GAGGCAGGGTGGTTGAGAGGAGG - Intergenic
1093206824 12:16261234-16261256 GAGGAAGGGGAAATGAGAAGGGG - Intronic
1093867794 12:24249192-24249214 GAGGGAGAGTAAATGTGAAGAGG + Intergenic
1095547315 12:43387595-43387617 GAGACAGAGCAATTGGGAAGGGG - Intronic
1096404941 12:51336897-51336919 GAGGCAGGGAGATTGCCTAGAGG - Intronic
1096795087 12:54071814-54071836 GTGGCAGGATAATTGGGGAGGGG - Intergenic
1100446017 12:94660887-94660909 GAGGCAGGAGAATTGGGAGGCGG - Intergenic
1103600809 12:122053468-122053490 GAGGCAGAGTAATAACAAAGGGG - Intronic
1103899970 12:124298352-124298374 AAGGCAGGGTATCTGGGAAGCGG + Intronic
1108296588 13:49026464-49026486 CAGACAGGGTAGTTGCTAAGAGG + Intronic
1111801255 13:92983775-92983797 GAGACTGGGTAATTATGAAGAGG - Intergenic
1112431537 13:99354746-99354768 GAGGCAGTGTCATTGTGAAAGGG + Intronic
1114193691 14:20459603-20459625 GAGGAAGGGGTATTGGGAAGGGG - Intronic
1117772754 14:59151331-59151353 GAGCCAGGGTAGTGGCGATGGGG + Intergenic
1118043362 14:61940736-61940758 GAGGGAGGGAAATGGAGAAGGGG - Intergenic
1118096748 14:62546126-62546148 GGGGCAGGGTAATAGCTAAGGGG - Intergenic
1120759710 14:88274462-88274484 GAGGCAGGAGAATTGGGAGGAGG + Intronic
1124373093 15:29114493-29114515 GAGGCAGGATCATTGGGAGGGGG + Intronic
1125828493 15:42694827-42694849 GAGACAGGGTAAATGGAAAGAGG + Intronic
1127799762 15:62467593-62467615 GAGGCAGGAGAATCGCCAAGAGG + Intronic
1129943447 15:79518703-79518725 GTTGCAGGGTATTTGCAAAGGGG + Intergenic
1136287229 16:29251661-29251683 GAGGCAGGGTGTTAGCCAAGCGG + Intergenic
1137556138 16:49471601-49471623 GAGGCAGGGTAAGCTGGAAGGGG - Intergenic
1137685239 16:50382225-50382247 GAGGCAGGGTAAACAGGAAGAGG - Intergenic
1137968714 16:52962367-52962389 GGGGAAGGGTAAATGAGAAGAGG - Intergenic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1141505898 16:84478368-84478390 GAGTCAGGGCTATTGCTAAGTGG + Exonic
1142092840 16:88224294-88224316 GAGGCAGGGTGTTAGCCAAGCGG + Intergenic
1148844313 17:50519834-50519856 GAGGCAGGGTAGTGTGGAAGTGG + Intronic
1149477515 17:56975545-56975567 AAGGCAGGGGAATTGCAATGGGG - Intergenic
1151235824 17:72719284-72719306 GAGGCAGGGGAAATGCTCAGAGG - Intronic
1151598575 17:75092921-75092943 GTTGCAGGGTAACTGCAAAGGGG + Intronic
1151858140 17:76737429-76737451 GCGGCAGGGTCGTTACGAAGCGG - Exonic
1152816778 17:82412524-82412546 GAGTCAGGGTCATTGGGCAGAGG + Intronic
1153615484 18:6929712-6929734 GAGGCAGGGTCACTGCGGATGGG - Intergenic
1153838247 18:8983387-8983409 GAGGCAGGGTTATTCCTGAGGGG + Intergenic
1156920268 18:42513885-42513907 GAGGAAGGGGAATTGAGCAGGGG - Intergenic
1157637032 18:49168863-49168885 GAGGAAGAGTAATTCAGAAGGGG + Intronic
1158988098 18:62839620-62839642 GAGGCACGAAAATTGCGAACTGG + Intronic
1160624995 18:80197820-80197842 GAGGCAGGGGAACAGAGAAGCGG + Intronic
1160949541 19:1658816-1658838 GAGGAAGGGTAACTGAGCAGAGG + Intergenic
1167501797 19:49852224-49852246 GAGGCAGTGTATTTAAGAAGCGG - Intronic
926645917 2:15289602-15289624 CAGGCAGGGTAACTGTGAAGAGG - Intronic
927997562 2:27496678-27496700 GAGTCAGGGTGCTTGCAAAGAGG + Intergenic
935230065 2:101088382-101088404 GAGGCAGGAGAATTGCGGTGAGG - Intronic
940142176 2:150504251-150504273 GAGGCTGGGTAATTTCTAAGGGG + Intronic
941702655 2:168620729-168620751 CAAGCAGGGTAATAGAGAAGGGG + Intronic
942128220 2:172848555-172848577 GAGTCAGGGCAAATGCTAAGGGG + Intronic
946337908 2:219050586-219050608 GAGGAAGGGTACTTACGGAGAGG + Intergenic
948526823 2:238575950-238575972 GACGCAGGGGAATAGCGCAGTGG - Intergenic
1168947549 20:1774041-1774063 GAGGCTGGGTCATGGAGAAGAGG + Intergenic
1169073126 20:2745829-2745851 GAGGAAGGGTCCTTGGGAAGGGG - Intronic
1172162532 20:32878658-32878680 GAGGCAGGGTATTGGCAAAATGG - Intronic
1173420499 20:42896839-42896861 AAGGCAGGGTAATATCTAAGTGG + Intronic
1182285427 22:29244210-29244232 GAGACAGAGTAAATGAGAAGGGG + Intronic
949875717 3:8624923-8624945 GATGCAGGGCAATTGGGGAGTGG - Intronic
955536281 3:59927289-59927311 GATGCAGGGTAACTGCTAATGGG + Intronic
957315222 3:78567976-78567998 GAGGCTGGAAAATTACGAAGAGG - Intergenic
963492607 3:146019634-146019656 CAGGGAGTGTAATTGCTAAGAGG - Intergenic
967302201 3:188025784-188025806 AAGGCAGTGTGATTGGGAAGCGG - Intergenic
967478480 3:189947539-189947561 AAGGCAGGCTAATTTCGAATTGG - Intergenic
968618666 4:1593660-1593682 TAGACAGGGTAATTGCAGAGCGG + Intergenic
969618222 4:8265829-8265851 GAGTCAGGGTGATTTCCAAGAGG + Intergenic
970072042 4:12171199-12171221 GAGGAAGGTGAATTGCAAAGTGG - Intergenic
972844939 4:42976095-42976117 GTGGCAGGATACTTGTGAAGTGG + Intronic
973820860 4:54660133-54660155 GAGGCAGAGGAATTTCAAAGAGG - Intronic
983007892 4:162507818-162507840 GAGGCAGGTTATTGGAGAAGGGG + Intergenic
987180616 5:15363907-15363929 GCTGCAGGTTAATTGTGAAGCGG + Intergenic
987207515 5:15642729-15642751 GAAGCAGGGTAGGTGGGAAGAGG + Intronic
991061875 5:62384758-62384780 GAGGAAGGGGGATTGTGAAGGGG - Intronic
991944206 5:71883783-71883805 GAGGCAGAGTAAGAGGGAAGGGG + Intergenic
992346878 5:75888399-75888421 GAGGTTGGGTAATTGGGAAAGGG - Intergenic
992501074 5:77344641-77344663 GAGGCAGGGCCTTTGGGAAGTGG - Intronic
996329802 5:122315846-122315868 GAGGCAGGAAAATTGGAAAGGGG + Intronic
997429128 5:133825416-133825438 GAGGCAGAGGAATTGCAATGAGG - Intergenic
997836720 5:137200256-137200278 GAGGCAGGGACATTGGGGAGAGG - Intronic
999495740 5:152095141-152095163 GAGGCAGTGTAATTCTGGAGTGG + Intergenic
1001477210 5:172059131-172059153 GAGGCAGGAGAATGGCGCAGTGG + Intronic
1006122220 6:31814612-31814634 GAGGCGGGGTAACTGGGAAGCGG - Intronic
1006605053 6:35250115-35250137 AATCCAGGGTAATTGCGCAGAGG + Exonic
1007461366 6:42021598-42021620 GAGGCAGGGTATGTGGGAGGAGG + Intronic
1010119166 6:72353635-72353657 GAGGGAAGGTGATTGGGAAGTGG + Intronic
1012329670 6:97968854-97968876 GAGGCAGGATAATCGCGAAGAGG + Intergenic
1016704319 6:147089125-147089147 GAGGGAGGGTAACTGCCCAGTGG - Intergenic
1017747070 6:157456451-157456473 GAGCCAGGGTTTTTGCAAAGTGG + Intronic
1018255402 6:161913075-161913097 GAGGCAGGAGAATTGCCCAGAGG + Intronic
1021796923 7:24265091-24265113 GAAGCAGGCTAATTGAGAAATGG + Intergenic
1027204019 7:76082786-76082808 GGGGCAGGGTAAGTGGGGAGGGG - Intergenic
1031085630 7:117299134-117299156 GGGGCAGTGTAATTCCGAAGAGG - Intronic
1032224498 7:130020357-130020379 GAGGCAGGAGAATTGGGAGGTGG - Intronic
1034235541 7:149565806-149565828 GAGAGAGGGTAATTGGGAAGGGG - Intergenic
1034235840 7:149568470-149568492 GATCCAGGGTATTTGAGAAGGGG + Intergenic
1034613349 7:152392413-152392435 GAAGTAGGGTCATTGTGAAGTGG - Intronic
1038506377 8:28088559-28088581 GAGGCAGGAGAATTGGGAGGTGG - Intergenic
1047033626 8:120911503-120911525 GAGGAAGGGTAATTGAGAGAAGG - Intergenic
1047858898 8:128942691-128942713 GGGGCAAAGTAATTGAGAAGGGG - Intergenic
1048019883 8:130528303-130528325 TAGGCATGTTAATTGCCAAGAGG - Intergenic
1053374679 9:37595462-37595484 GAGGCAAAGTGATTGGGAAGGGG + Intronic
1055503166 9:76921928-76921950 GAGACTGGGTAATTGAAAAGAGG - Intergenic
1056496172 9:87157586-87157608 GAGGCAGCATAATTTGGAAGCGG + Exonic
1056811028 9:89764049-89764071 GAGAGTGGGTAAATGCGAAGGGG + Intergenic
1057665625 9:97042964-97042986 GAGGCAGGAGAATCGCGGAGAGG + Intergenic
1059172432 9:112138543-112138565 GAGGCAGGAGAATTGGGAGGTGG - Intronic
1059202200 9:112428757-112428779 GAGGAAGGGTAATTGAGAAAGGG - Intronic
1061073955 9:128329464-128329486 GAGGCAGGAGAATTGCCAGGAGG - Intronic
1062121461 9:134836139-134836161 GAGGCCGGGTAAACGGGAAGCGG + Intronic
1190903777 X:54705357-54705379 GAGGATGGGGAATTGCCAAGTGG - Intergenic
1192137382 X:68616481-68616503 GAGGCTGGGTAATTTATAAGAGG + Intergenic
1198788862 X:140320323-140320345 GAGGCAGGATAATTTGAAAGTGG + Intergenic
1199800553 X:151247104-151247126 GAGTCAGGTTAATTGAGAGGAGG + Intergenic
1199935336 X:152567927-152567949 TAGGCAGGGTGATTGCTAAACGG - Intergenic