ID: 916660744

View in Genome Browser
Species Human (GRCh38)
Location 1:166920763-166920785
Sequence GGTCGCGGCCGCGGTAGGAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916660733_916660744 16 Left 916660733 1:166920724-166920746 CCTTTTTCCTCTTCTTCTCCGAG 0: 1
1: 0
2: 6
3: 60
4: 519
Right 916660744 1:166920763-166920785 GGTCGCGGCCGCGGTAGGACGGG 0: 1
1: 0
2: 0
3: 4
4: 74
916660734_916660744 9 Left 916660734 1:166920731-166920753 CCTCTTCTTCTCCGAGTTGCTGT 0: 1
1: 0
2: 0
3: 23
4: 202
Right 916660744 1:166920763-166920785 GGTCGCGGCCGCGGTAGGACGGG 0: 1
1: 0
2: 0
3: 4
4: 74
916660738_916660744 -2 Left 916660738 1:166920742-166920764 CCGAGTTGCTGTGGTAGGGCAGG 0: 1
1: 0
2: 3
3: 32
4: 231
Right 916660744 1:166920763-166920785 GGTCGCGGCCGCGGTAGGACGGG 0: 1
1: 0
2: 0
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916660744 Original CRISPR GGTCGCGGCCGCGGTAGGAC GGG Exonic
901793035 1:11664423-11664445 GGTCGCGTCCCCGGGGGGACGGG + Intronic
911208680 1:95117732-95117754 GCTCTCGGCCGCGCTAGGCCAGG - Intronic
912401475 1:109397470-109397492 GGACGCGGGCGCGGCAGGGCTGG + Intronic
915912757 1:159924693-159924715 GGTGGTGGCCGCGGGCGGACGGG - Intronic
916660744 1:166920763-166920785 GGTCGCGGCCGCGGTAGGACGGG + Exonic
923685050 1:236147882-236147904 GGAGGCGGCTGTGGTAGGACTGG + Intronic
1064199793 10:13274643-13274665 GGTCACGGGAGCTGTAGGACAGG - Intergenic
1069818276 10:71212417-71212439 GGGCGCGGCCGCGGCAGAGCTGG - Intergenic
1077080446 11:722537-722559 GGATGCGGCCCCGGTAGGGCAGG + Exonic
1077327759 11:1971079-1971101 GGCCGGGGCCCCGGGAGGACAGG - Intronic
1078450459 11:11437026-11437048 GGTCCCGGCTGCGGCAGGACTGG - Intronic
1083225420 11:61281630-61281652 GGGCGGGGCCGGGGTAGGGCGGG + Intronic
1084642469 11:70434098-70434120 GCTGGCGGCCGGGGCAGGACAGG - Intronic
1090635802 11:128689862-128689884 GGCCGCGGCGGCGGGAGGGCCGG - Intronic
1097787808 12:63780117-63780139 AGACGCGGCCGAGGTAGGACTGG + Exonic
1101606115 12:106248308-106248330 GGACGCGGCCGAGGTGGGGCTGG + Intronic
1105409596 13:20160890-20160912 GGTCGCCGCCGCGGCAGAGCGGG - Exonic
1116944338 14:50822120-50822142 GGTGGTGACCACGGTAGGACTGG - Intronic
1118752447 14:68816791-68816813 GAGAGCGGCCGCGGGAGGACGGG - Intergenic
1127982699 15:64046319-64046341 GGTCGCGGCCGCGGCAGGCGCGG + Intronic
1128454527 15:67825237-67825259 GGTGGGGGCCGCGCTAGGTCCGG + Intronic
1128651153 15:69414596-69414618 GGTCGCGGCCGCAGCAGCACCGG - Intronic
1131260395 15:90884645-90884667 GGTAGGGGCCGCGGAAGGGCGGG + Intronic
1132512695 16:352322-352344 GGGCTAGGCCGCGGTAGGCCGGG - Intronic
1136611966 16:31371806-31371828 GGTGGCGGCCGCGCTGGGGCTGG + Intronic
1139390603 16:66604783-66604805 GGCGGCGGCGGCGGTAGGGCCGG - Exonic
1143747270 17:9003590-9003612 GGGCGCGGGCGCGGCAGGGCCGG - Intergenic
1147508768 17:41047186-41047208 GGTCGCGGCAGCAGCAGGGCTGG + Exonic
1147509507 17:41055130-41055152 GGTCGCGGCAGCAGCAGGGCTGG + Exonic
1147510015 17:41059969-41059991 GGTCGCGGCAGCAGCAGGGCTGG + Exonic
1147510608 17:41065764-41065786 GGTCGCGGCAGCAGCAGGGCTGG + Exonic
1150228729 17:63538360-63538382 GGACGCGGCCGGGGTGGGGCTGG - Intronic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1165305454 19:35000352-35000374 GGCGGCGGCCGCGGAAGGCCAGG + Exonic
1166949398 19:46416535-46416557 GGGCGGGGCCGCGGGAGGCCCGG - Intergenic
925344319 2:3159873-3159895 CGTCTTTGCCGCGGTAGGACTGG + Intergenic
925984720 2:9206708-9206730 GGGCGGGGCGGCGGGAGGACCGG - Intergenic
926077129 2:9951038-9951060 GCGCGCGGCCGCGGTGGGCCAGG + Intergenic
941021009 2:160407873-160407895 GGTTGAGGCCGCGGTAGGTGGGG - Intronic
947418478 2:229921693-229921715 CGGCGGGGCCGCGGAAGGACCGG - Intronic
948150965 2:235744378-235744400 GGTCGGGGCAGCGGGCGGACAGG + Intronic
948874629 2:240820083-240820105 GGGCGCGGGCGCGGGAGGCCGGG + Intronic
1172130228 20:32650373-32650395 GGTGGTGGCCTTGGTAGGACAGG + Intergenic
1179912004 21:44455534-44455556 GGTCGCGGGCGCGGTCGCAGGGG + Exonic
1181084055 22:20431118-20431140 GGCAGCGGCCGCGGAAGCACTGG + Exonic
1182445562 22:30387417-30387439 GGGCGGGGCCGCGGCCGGACGGG + Intronic
1183050688 22:35258006-35258028 GGCCGCGGCCACGGGAGGGCTGG + Intronic
1183665143 22:39242561-39242583 GGGGGCGGCCGCGGAAGGGCGGG + Intronic
953947656 3:47163609-47163631 TGTCGCGGCGGCGGTTGGGCCGG - Intronic
954275665 3:49540081-49540103 GCTAGCGGCCGCGCTCGGACTGG - Intergenic
954796089 3:53161896-53161918 GGGCGCGGCTCCGGGAGGACGGG - Intronic
960864344 3:122184517-122184539 GGCCGCGGCGCAGGTAGGACCGG + Exonic
968051543 3:195658203-195658225 GGGCGAGGCGGCGGTAGGAGCGG + Intergenic
968104274 3:195990130-195990152 GGGCGAGGCGGCGGTAGGAGCGG - Intergenic
968302575 3:197627720-197627742 GGACGAGGCGGCGGTAGGAGCGG - Intergenic
968908370 4:3464620-3464642 GGTCGGGGCCGTGGTGGGGCAGG + Intronic
984928381 4:184826092-184826114 GGGCGGGGCCGCGGGAGGGCGGG - Intronic
985497610 5:218456-218478 GGCCGAGGCGGCGGTAGGAGCGG + Intronic
985737712 5:1594335-1594357 GGCCGAGGCGGCGGTAGGAGCGG - Intergenic
990308955 5:54519356-54519378 GGCTGAGGCCGCGGAAGGACTGG - Exonic
992171361 5:74105253-74105275 GGTCAGGGCCGTGGTGGGACAGG - Intergenic
1002539433 5:179896350-179896372 GATCGCAGCTGCGGTAGCACTGG - Intronic
1006840032 6:37022648-37022670 GGTGGAGGCCGAGGTGGGACAGG - Intronic
1013273227 6:108560972-108560994 GGAGGCGGGCGCGGCAGGACTGG + Exonic
1014205372 6:118651083-118651105 GGAGGCGGCCGGGGTAAGACAGG + Intronic
1017146772 6:151241252-151241274 GGCCGCTGCCGCAGGAGGACTGG - Intronic
1019313584 7:374540-374562 GGTAGCCGCCGCGGTGGGAGTGG - Intergenic
1020445398 7:8262214-8262236 GGTGGCGGCCGCCGCAGGAAGGG - Exonic
1024286659 7:47763596-47763618 TGTCGTGGCCACGGGAGGACCGG + Intronic
1029109562 7:98205717-98205739 GGCCGCGGCCGCGGGTGCACGGG - Exonic
1034213768 7:149387359-149387381 GGGCGTGGCAGGGGTAGGACAGG - Intergenic
1051855501 9:21559899-21559921 GGTCGCGGCGGCGGCTGGAGCGG - Intergenic
1059234704 9:112751333-112751355 GGTCGCAGCCGCAGAGGGACAGG + Intronic
1059247085 9:112857549-112857571 GCTCGTGGCTGCTGTAGGACAGG - Intronic
1187648291 X:21374025-21374047 GGTGGCGGCCACGGCGGGACGGG - Intergenic
1187826286 X:23335261-23335283 CGCCGCGGCCGCGGTCGGGCTGG + Intronic
1191830017 X:65406707-65406729 GGCGGCGGCGGCGGTAGGAGCGG + Intronic
1192261093 X:69506187-69506209 GGCAGCGGCCGCAGTGGGACCGG + Intronic
1200073377 X:153539685-153539707 GGTCACGGCCGCGACAGCACTGG + Intronic