ID: 916664046

View in Genome Browser
Species Human (GRCh38)
Location 1:166949199-166949221
Sequence GGGATGCTGTGGCATCTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916664046_916664053 29 Left 916664046 1:166949199-166949221 CCCACTAGATGCCACAGCATCCC 0: 1
1: 0
2: 4
3: 21
4: 170
Right 916664053 1:166949251-166949273 AAACATTGCCAAATATCTCCTGG 0: 1
1: 22
2: 135
3: 638
4: 1478

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916664046 Original CRISPR GGGATGCTGTGGCATCTAGT GGG (reversed) Intronic
901425434 1:9179775-9179797 AGGGTGCTGTGGCAACTATTAGG - Intergenic
903508422 1:23854747-23854769 GGGGTGGTATGCCATCTAGTGGG + Intronic
904212222 1:28893553-28893575 GGGACGCTGCTGCCTCTAGTGGG + Intronic
904994211 1:34618301-34618323 GGGTTGCACTGGCATCTAGTGGG + Intergenic
905923091 1:41732057-41732079 GGAAGGCTGTGGCATGTGGTGGG + Intronic
907596090 1:55721274-55721296 GGAGTGCTATGGCATCTGGTGGG + Intergenic
914439964 1:147696379-147696401 GGTATGATGTGGTATCTCGTTGG + Intergenic
915645920 1:157272265-157272287 GGGATGCTGTGTCTTCATGTGGG - Intergenic
916664046 1:166949199-166949221 GGGATGCTGTGGCATCTAGTGGG - Intronic
917833813 1:178923580-178923602 GGGTTCTTCTGGCATCTAGTAGG + Intergenic
918235317 1:182574635-182574657 AGCATGCTATGGCATTTAGTGGG - Exonic
919479317 1:198067772-198067794 GGTACTCTGTGGCATATAGTAGG + Intergenic
920082535 1:203385730-203385752 GAGATGCTGAGGCATCTACATGG - Intergenic
920154057 1:203934005-203934027 GGGAGGCTGTGGGACCAAGTAGG - Intergenic
921033415 1:211353805-211353827 GAGGTGCTGTGGCACCTAGAAGG + Intronic
922981846 1:229833627-229833649 GGCAGGCTGTGGCTTCTCGTGGG - Intergenic
924772237 1:247088342-247088364 TGGCTGCTATGGCATCTGGTGGG - Intergenic
1066068744 10:31782909-31782931 GGGAAGCTGTGGCATATACAGGG - Intergenic
1068011729 10:51460117-51460139 GGGGTCCTCTGGCATTTAGTGGG - Intronic
1070200089 10:74196041-74196063 GGGAGGCTGAGGCATGTAGATGG - Intronic
1072663335 10:97376689-97376711 TGGGTGCTCTGGCATCTAGTGGG - Intronic
1075638937 10:124050526-124050548 GGGGTGCTATGGCATCCAGTGGG - Intronic
1075653850 10:124148133-124148155 AGGATGCTATGGCATCTAGGAGG - Intergenic
1076205022 10:128590695-128590717 GGGATGCTGTGACTTCAGGTGGG + Intergenic
1077111052 11:862397-862419 GGGCTGCCGTGGGATCTAGCAGG + Intronic
1077706646 11:4493206-4493228 TGGATGCTGTGGCCTCCAGATGG + Intergenic
1080643127 11:34169660-34169682 AGGCTGCTGTGGGATCTCGTGGG - Intronic
1081567815 11:44270626-44270648 GGGTTGGTGTGGCATCTGGAAGG - Intronic
1087749272 11:101989383-101989405 GAAGTGCTGTGGCATCTAGTGGG - Intronic
1088979903 11:114852880-114852902 AGGATGCTATTGCATCTAGTGGG - Intergenic
1091437255 12:482241-482263 GGTGTGCTGTGGCTGCTAGTAGG - Intronic
1101832608 12:108271143-108271165 GGTATCCTGAGGCATCTAGCAGG - Intergenic
1103234180 12:119358425-119358447 GGGCTGGCGTGGCATCTTGTGGG - Intronic
1104576537 12:129971862-129971884 GAGGTGCTATGGCACCTAGTGGG - Intergenic
1104582537 12:130021735-130021757 AGGTTGCTATGGCATCTAATGGG + Intergenic
1104617848 12:130285286-130285308 GGGTTCCACTGGCATCTAGTAGG + Intergenic
1104906324 12:132215377-132215399 GGGCTGCAGTGGCATCCAGGCGG - Intronic
1105465642 13:20637227-20637249 AGAATTCTGTGGCATTTAGTAGG - Intronic
1105715728 13:23062302-23062324 GGTATGCTGTGGCTTCTTCTAGG - Intergenic
1112576751 13:100642959-100642981 GGGATGTTTTGGCTTCTTGTTGG - Intronic
1114810956 14:25898897-25898919 GGGATGCTTGGGCTTTTAGTTGG - Intergenic
1120038935 14:79730213-79730235 GGGATGCTGTGGCACAAAGTGGG - Intronic
1122018009 14:98813277-98813299 GGCAGGCTCTGGCCTCTAGTTGG - Intergenic
1127354803 15:58188240-58188262 GGGAGGCAGTGGCAGATAGTAGG - Intronic
1127889664 15:63238409-63238431 GAGATGTTGTGGCAGCTACTTGG + Intronic
1128222116 15:65976745-65976767 GGACTGCTGTGGCATCTAGAAGG + Intronic
1128570181 15:68728049-68728071 GGGTTGCTATGGCATCTGATTGG - Intergenic
1129778563 15:78253525-78253547 GGGATGCTGTGGCATCATCATGG - Intergenic
1130366976 15:83249482-83249504 GGGGTGCTATGGCATTTAGTGGG + Intergenic
1131067309 15:89442596-89442618 GGGGTGCTGTGGCAGCTTGCCGG + Intergenic
1131558635 15:93420449-93420471 GGGATAGTGTTGCTTCTAGTGGG + Intergenic
1131947749 15:97645924-97645946 GGAATGCTGAGTCATGTAGTAGG - Intergenic
1132376879 15:101334035-101334057 GGGATGCTGTTTCATGTAGGAGG - Intronic
1132646762 16:1002798-1002820 GGGGTGCTGTGGCATCCAGCGGG - Intergenic
1132692899 16:1189541-1189563 GGGGTGCGGTGGCAGCTACTCGG - Intronic
1133800689 16:9082695-9082717 GGGTTGCTGCCACATCTAGTGGG - Intergenic
1134329195 16:13235189-13235211 GGGATGTGGGGGCATCTTGTTGG - Exonic
1134827767 16:17298225-17298247 CGGATGGTGTCACATCTAGTGGG + Intronic
1138142795 16:54582998-54583020 TGGATGGTGTGGCATCCAGGAGG - Intergenic
1138923357 16:61560151-61560173 GAGATGCTGAGGCATGAAGTGGG - Intergenic
1141631619 16:85291143-85291165 GGGAAACTGAGGCATGTAGTGGG + Intergenic
1146307535 17:31742218-31742240 GGGCCTCTGTGGCTTCTAGTGGG - Intergenic
1148221890 17:45868839-45868861 GAGGTGCTATAGCATCTAGTGGG + Intergenic
1148777702 17:50104917-50104939 GGGGTGTTGTTGCATCCAGTGGG - Intronic
1148875879 17:50686895-50686917 GGGATGCTGTGGCCTCTGGTTGG + Intronic
1149604373 17:57914529-57914551 GGGATCCTGTTGCATCCATTTGG + Intronic
1150389741 17:64783416-64783438 GGGAAGCTGTGGCACCTAGATGG + Intergenic
1151948482 17:77332347-77332369 TGGTTGCTGTGGAATCTAGGTGG - Intronic
1152187771 17:78868917-78868939 CGGGTGCTGTGGCATGTAGAGGG + Intronic
1152896432 17:82913993-82914015 GGAATGTTGTGGGTTCTAGTTGG + Intronic
1154027953 18:10725439-10725461 GGCATGCTGTGGCATGAAATAGG + Intronic
1157090829 18:44634949-44634971 GGAAAGCTGTGGCATCTTGAAGG - Intergenic
1161271845 19:3394066-3394088 GGGAAGCTGAGGCAGCTACTCGG - Intronic
1161358175 19:3831390-3831412 GGGAAGCGGTGGCTTCGAGTCGG + Exonic
1161551435 19:4915027-4915049 AGGATGCTCTGGCATGGAGTGGG - Intronic
1161934750 19:7364742-7364764 TGGAAGATGTGGCATCTAGGAGG + Intronic
1162339699 19:10085267-10085289 GGGAACCACTGGCATCTAGTGGG + Intergenic
1167504469 19:49863805-49863827 GGGCTGGGGTGGCATCCAGTAGG - Intronic
1168141209 19:54388573-54388595 GGGAAGCCGTGGCATCCAGGTGG - Intergenic
1168468843 19:56625005-56625027 GGGATGCTGTGGTACCAGGTGGG + Exonic
925326484 2:3026080-3026102 GGCATCCTGTGGCTTCTAGATGG - Intergenic
929568947 2:43007709-43007731 GGGTTGGTGTGGGATCTGGTGGG - Intergenic
933911865 2:86948039-86948061 GCGATGATGTGGCATCTCTTAGG + Intronic
934011130 2:87821855-87821877 GCGATGATGTGGCATCTCTTAGG - Intronic
935188597 2:100757235-100757257 ACGATGCTGTGGCATCAAGTAGG + Intergenic
935497322 2:103796482-103796504 AGGATTATGTGGCAACTAGTAGG + Intergenic
935640073 2:105281881-105281903 GGTGTGCTATGGCATCTAGTAGG + Intronic
935774693 2:106462574-106462596 GCGATGATGTGGCATCTCTTAGG - Intronic
935905374 2:107833341-107833363 GTGATGATGTGGCATCTCTTGGG + Intronic
935991741 2:108725064-108725086 GAGATGATGTGGCATCTCTTAGG + Intronic
936127165 2:109798522-109798544 GCGATGATGTGGCATCTCTTAGG + Intronic
936217532 2:110572964-110572986 GCGATGATGTGGCATCTCTTAGG - Intronic
936426674 2:112427539-112427561 GCGATGATGTGGCATCTCTTAGG - Intronic
936618516 2:114072375-114072397 TGGATGCTGTGGCACATAGGTGG + Intergenic
938778025 2:134559242-134559264 TGGCCCCTGTGGCATCTAGTTGG + Intronic
939200887 2:139032022-139032044 GGGATGTTGTGCCACCTGGTGGG + Intergenic
941620925 2:167777927-167777949 ATGGTGCTGTGGTATCTAGTAGG + Intergenic
942371976 2:175294986-175295008 GAGATGCTGTGGGACCTAGCAGG - Intergenic
942798566 2:179850055-179850077 ATAATGCTGTGGCATATAGTAGG + Intronic
946009816 2:216555479-216555501 GGGCTGCTTTGGCTTCTTGTGGG - Intronic
946072788 2:217048749-217048771 TGGATGCTCTGGCTTCCAGTAGG + Intergenic
948253335 2:236548532-236548554 GGGAGGGTGTGGCATCTTGCAGG + Intergenic
948447439 2:238043739-238043761 GGGAAGCTCTGACATCCAGTTGG + Intronic
948625571 2:239266064-239266086 AGGCTGCTGTGGCATCCAGAGGG + Intronic
948974903 2:241458082-241458104 GGGATGCTGTGGCCTCAGGGTGG + Intronic
1172489435 20:35323395-35323417 GGGATGCTATTACATCTACTTGG - Intronic
1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG + Intronic
1175579353 20:60087172-60087194 GGCAGGCTGTAGCACCTAGTAGG + Intergenic
1176720061 21:10385366-10385388 GCGATGCTGGAGCTTCTAGTGGG - Intergenic
1177830631 21:26134863-26134885 GTGATACTGTGGCATCTATTTGG - Intronic
1179086568 21:38223451-38223473 GGGATGCTGTGAAATCTAGTTGG + Intronic
1180653280 22:17397008-17397030 GGGAATCTGTGGCAGTTAGTGGG + Intronic
1180893325 22:19307792-19307814 GGGAGGCTGTGGCAGGTAGATGG - Intergenic
1181443962 22:22954071-22954093 GGGCTGCTGTGTCACATAGTGGG + Intergenic
1183258900 22:36781543-36781565 AGCTTGCTCTGGCATCTAGTGGG - Intergenic
1183523295 22:38309087-38309109 GGGGTGCCCTGGCATCTAGTGGG - Intronic
1185159492 22:49214657-49214679 GGGTTGCTGTTGCATGCAGTAGG + Intergenic
949905611 3:8856060-8856082 GCTGTGCTGTTGCATCTAGTGGG + Intronic
950123676 3:10498477-10498499 GGAATGCTGTGGCAGCCATTTGG - Intronic
950142811 3:10627127-10627149 GGGAAGCTTTGGCATCTGGCAGG - Intronic
953470058 3:43158798-43158820 GGGATGCTGTGTTATATAGGGGG + Intergenic
955215183 3:56979465-56979487 GGGAAGGTGTGGCATCTTGGGGG - Intronic
955347870 3:58174081-58174103 AGGAGGCAGTGGCTTCTAGTGGG - Intergenic
955501505 3:59588930-59588952 GGGAGGCTGAGGCAGCTACTTGG - Intergenic
960984631 3:123268035-123268057 GGGATTCATTGCCATCTAGTGGG + Intronic
961234619 3:125355391-125355413 GGGTTCCACTGGCATCTAGTGGG - Intronic
967245634 3:187483787-187483809 GGGTTGTACTGGCATCTAGTTGG + Intergenic
968354223 3:198089864-198089886 AGGAGACAGTGGCATCTAGTGGG + Intergenic
972605930 4:40613959-40613981 GGGAGCTTCTGGCATCTAGTAGG - Intronic
973590095 4:52432591-52432613 TGGAAGATGTCGCATCTAGTAGG - Intergenic
975812074 4:78179857-78179879 AGGATGCTGTGGCAATCAGTGGG + Intronic
976428301 4:84931613-84931635 TGGATCCTGTGGCATCTCCTGGG + Intronic
977564081 4:98563850-98563872 AGGGTGCACTGGCATCTAGTGGG + Intronic
981710928 4:147708284-147708306 GGGATTTAGTGGCATTTAGTAGG - Intergenic
992035552 5:72771350-72771372 GGGATGTTGGGGAATTTAGTTGG + Intergenic
992351069 5:75929401-75929423 GGGAAGCTGCGGCATCTGCTTGG + Intergenic
992400384 5:76405377-76405399 GGGGTGGTGTGCCATCTTGTTGG + Intronic
992895403 5:81240875-81240897 GGGTTGCTGTGGCAAGTGGTGGG + Intronic
996425059 5:123305189-123305211 GGGAGGCTGTGGAAGGTAGTTGG - Intergenic
997329344 5:133047720-133047742 GGGACTTTGTGGCATCTAGCCGG - Intergenic
997876923 5:137557957-137557979 GGGAAGATGTGGAATCTATTAGG + Intronic
1000298975 5:159937960-159937982 GGGAAGCTTTGGCCTCCAGTGGG - Intronic
1001073497 5:168606722-168606744 TGGATGGTGTGGCACATAGTAGG + Intergenic
1001687042 5:173601255-173601277 GGGATGATGGGGCATCGGGTCGG + Intergenic
1001812763 5:174642316-174642338 GAGAGTATGTGGCATCTAGTAGG - Intergenic
1007370257 6:41422227-41422249 GGGATGCTGGGGCAGCTGGCAGG - Intergenic
1010047559 6:71464177-71464199 GTGATGCTGTGGCAGCTTCTTGG + Intergenic
1010166209 6:72917984-72918006 GGGGTGCTATTGCGTCTAGTGGG - Intronic
1011778412 6:90758956-90758978 GGGCAGCTGTGTCATCGAGTAGG + Intergenic
1012430241 6:99156451-99156473 GGGATCCTGTGGAATGTATTGGG + Intergenic
1015473678 6:133635280-133635302 GGCATGCTGTGGCAGCTGGAAGG + Intergenic
1017516554 6:155161235-155161257 GGGATGCAGTGGCACATTGTTGG + Intronic
1019741272 7:2675705-2675727 GGTTTGCTGTGGCCTCCAGTGGG - Intergenic
1020208042 7:6134639-6134661 GTGATGCTGCAGCATCTAGTGGG - Intronic
1021894674 7:25222668-25222690 GGGATGTTGTGGGATCCAGCAGG + Intergenic
1022585409 7:31604113-31604135 GGGCTGCTGTGGCATCTACACGG + Intronic
1022953930 7:35364216-35364238 GGGATGCTGATGCTTCTGGTTGG + Intergenic
1023139266 7:37084805-37084827 GGGATGCAGTGGCATGATGTTGG + Intronic
1023838166 7:44080435-44080457 GAGTTGCTGTGTCATCTACTTGG + Intronic
1024755793 7:52529234-52529256 GGCTTGCTGTGGCATCTTTTGGG + Intergenic
1026885944 7:73945348-73945370 GGAATGCTATGTCATCTGGTAGG + Intergenic
1029510654 7:100992778-100992800 GGGCTGCTGTGGTAGCTGGTAGG - Exonic
1029511143 7:100996027-100996049 GGGCTGCTGTGGTAGCTGGTAGG - Exonic
1029511871 7:101000698-101000720 GGGCTGCTGTGGTAGCTGGTAGG - Exonic
1029512363 7:101003947-101003969 GGGCTGCTGTGGTAGCTGGTAGG - Exonic
1029512444 7:101004526-101004548 GGGCTGCTGTGGTAGCTGGTAGG - Exonic
1029891585 7:103935582-103935604 GGGATCCTTTGGCATGTAGATGG - Intronic
1031483137 7:122301854-122301876 GGGATGCAGAGGCTTCTGGTCGG + Exonic
1033006314 7:137568356-137568378 GGGAGCCTGTGGCATGCAGTTGG - Intronic
1034002601 7:147432248-147432270 GGGGTGCTATGCCATCTAGTGGG - Intronic
1034011526 7:147534189-147534211 GGGTTGCTATGGTATCTAATGGG + Intronic
1035583146 8:752756-752778 GGGATGCTGTGCCTTCAAGGTGG + Intergenic
1035703202 8:1653133-1653155 GAGATACTGTGGCATCGCGTTGG + Intronic
1036720823 8:11173457-11173479 ACGATGCTGTGCCATCTTGTAGG - Intronic
1037376284 8:18233566-18233588 GAAATGCTGTGGCATAGAGTGGG - Intergenic
1039750867 8:40477384-40477406 AGGATGCTCTGACATATAGTAGG - Intergenic
1039770195 8:40678501-40678523 GGGATTCAGTAGCATCTTGTGGG - Intronic
1043605564 8:81994401-81994423 GGGATGCAGTGGCACCCTGTTGG + Intergenic
1045447868 8:102286090-102286112 GGGTTTCACTGGCATCTAGTGGG + Intronic
1046826460 8:118696784-118696806 TGGATGCTGTATCATTTAGTTGG + Intergenic
1049876588 8:145026944-145026966 GGGATCCTGTGCCAAATAGTAGG - Intergenic
1052455494 9:28691827-28691849 GCTATGCTTTGGCATATAGTAGG - Intergenic
1056132004 9:83596475-83596497 AGGATGATTTGGCATATAGTTGG - Intergenic
1057526734 9:95809706-95809728 GTGATGCTAAGGCATGTAGTTGG - Intergenic
1061209817 9:129184614-129184636 GGGCTGCTGTGGCACACAGTAGG - Intergenic
1062020942 9:134319201-134319223 GTGACTCTGTGGAATCTAGTGGG + Intronic
1186323399 X:8453404-8453426 GGGGTGGATTGGCATCTAGTGGG - Intergenic
1186523768 X:10228951-10228973 GGGATGCTGCTGCATCTAGTGGG + Intronic
1186525276 X:10242597-10242619 GGGGTGCGATGGCATCTAGTGGG - Intergenic
1186630553 X:11344224-11344246 GGCATCCCCTGGCATCTAGTGGG - Intronic
1187457751 X:19457853-19457875 GGTGTGCTGTGGCTTCCAGTGGG - Intronic
1193839586 X:86392953-86392975 GTGGTGCTATGGCATCTAGTGGG + Intronic
1195732174 X:107978967-107978989 TGGATGCTCTGGCAACTAGTGGG + Intergenic
1195996610 X:110737944-110737966 AGGGTACTCTGGCATCTAGTGGG + Intronic
1200147855 X:153935617-153935639 GCGATGCAGTGGCATCTGGGCGG - Intronic
1201511548 Y:14769842-14769864 GGGATGCTGTGGCTTGGTGTGGG + Intronic