ID: 916665394

View in Genome Browser
Species Human (GRCh38)
Location 1:166962425-166962447
Sequence ATACCCAACCCTCAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916665394_916665397 1 Left 916665394 1:166962425-166962447 CCCTTCTCCTGAGGGTTGGGTAT 0: 1
1: 0
2: 0
3: 13
4: 152
Right 916665397 1:166962449-166962471 GTTTCCTATACCTTCATGCATGG 0: 1
1: 0
2: 2
3: 9
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916665394 Original CRISPR ATACCCAACCCTCAGGAGAA GGG (reversed) Intronic
900040340 1:456772-456794 ATACCTTATCCTCAGGAAAATGG + Intergenic
900061769 1:691743-691765 ATACCTTATCCTCAGGAAAATGG + Intergenic
903652025 1:24928420-24928442 ATCCCCCACCCCCAGGAGCACGG + Intronic
904273819 1:29367477-29367499 ACACGCCACCCTCAGGAGGATGG + Intergenic
904888621 1:33761150-33761172 ATATCCAACACTCAAGTGAAGGG - Intronic
910936024 1:92485087-92485109 ATTCCCATTCCTCCGGAGAAGGG - Intronic
912224907 1:107722215-107722237 AAACCCAACATTCAGCAGAAAGG - Intronic
912795263 1:112689402-112689424 ATACTCAGCCCTGGGGAGAAGGG - Exonic
916665394 1:166962425-166962447 ATACCCAACCCTCAGGAGAAGGG - Intronic
917465969 1:175276383-175276405 ATAACCATCCCCAAGGAGAAGGG - Intergenic
918337802 1:183538141-183538163 ATACTCAATGCTGAGGAGAATGG - Intronic
1065221007 10:23495909-23495931 ATTCCCTGCCCTCAGGAGACTGG - Intergenic
1065888116 10:30096681-30096703 ATACTTCAACCTCAGGAGAAGGG - Intronic
1068796637 10:61089490-61089512 TTTCCCAACCCCCAGGGGAAAGG + Intergenic
1070703775 10:78622499-78622521 ACACCCACCCCCAAGGAGAAGGG - Intergenic
1071236956 10:83660371-83660393 ATACAGAAACCTCAGCAGAAAGG - Intergenic
1071694577 10:87858283-87858305 ATCCCCTACCCTCAAGAGGATGG + Intergenic
1072531890 10:96327397-96327419 ACAACCAGCCCTCAGTAGAAGGG - Intronic
1073037942 10:100577360-100577382 AAACCAAATCCTCATGAGAAGGG + Intergenic
1073038479 10:100581157-100581179 AAAACCCACCCTCAGGAGATTGG - Intergenic
1073291944 10:102417452-102417474 GTACCCCACCCTCTGGAAAAGGG + Intronic
1073932765 10:108595098-108595120 ATGCCCAACCTTCAGGGGCATGG + Intergenic
1074084462 10:110197412-110197434 ATACCCAACCAACAGGTGACTGG + Intergenic
1076493235 10:130878161-130878183 AGACCCAACCCTCTTGAGTATGG - Intergenic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1076966560 11:92674-92696 ATACCTTATCCTCAGGAAAATGG + Intergenic
1079686900 11:23370590-23370612 AGACTCACCCCTCAGGAGAGTGG - Intergenic
1082942523 11:58722801-58722823 ATATCTAACACTCAGAAGAATGG + Intronic
1083603133 11:63961311-63961333 ATATCCAACATTCAGGAGAGGGG - Intergenic
1084426864 11:69088849-69088871 GCACCCAAACCTCAGCAGAAAGG - Intronic
1088792384 11:113237202-113237224 AGAACCAAATCTCAGGAGAAGGG - Intronic
1091792275 12:3278763-3278785 ATAACCAACCATGAGGAGGAGGG - Intronic
1092315206 12:7405029-7405051 ATGGCCAACCCACAGGAAAATGG - Intronic
1092589890 12:9943195-9943217 ATCTCCAACCCTCACGAGGAAGG + Intergenic
1093548681 12:20379669-20379691 CTACCTCAACCTCAGGAGAATGG - Intronic
1095300576 12:40580097-40580119 AAACCCAACCTTCAAGTGAAGGG + Intergenic
1100803344 12:98255991-98256013 ATAGGCAATCCTCAAGAGAAAGG - Intergenic
1104339094 12:127930467-127930489 ATGCTCAACCCTCTGCAGAAGGG - Intergenic
1107411976 13:40166430-40166452 ACAGCCAGGCCTCAGGAGAATGG + Intergenic
1108015193 13:46067361-46067383 ATCCACAAGCCTCAGGAGATTGG + Exonic
1111535977 13:89603874-89603896 GTCCCAAACCCTCAGGAGCAGGG + Intergenic
1111654777 13:91138941-91138963 GCACCCATCCCTCAGGAGGATGG - Intergenic
1115440384 14:33427736-33427758 ATTCCTAACACTCAGAAGAAGGG + Intronic
1116713678 14:48400770-48400792 CTACTCAACACTCAGGAAAAGGG + Intergenic
1117788589 14:59314149-59314171 AATCCCAACCCTCAGGAGAGTGG - Intronic
1119950377 14:78738462-78738484 AGACCCCACCCTCAGGACAGTGG + Intronic
1127933554 15:63614203-63614225 CCATCCAACCCTCAGAAGAAGGG + Intronic
1128449380 15:67794597-67794619 TTACCCGACCCTCAGTGGAATGG - Intronic
1128867965 15:71129842-71129864 ATGCGCAAGCCTCAGGAGCAGGG + Intronic
1131311918 15:91297903-91297925 ATCACCAACCCCCAGGGGAAAGG - Exonic
1132441569 15:101870849-101870871 ATACCTTATCCTCAGGAAAATGG - Intergenic
1134812502 16:17179630-17179652 ATTCCCAACCCCCAGCAAAATGG + Intronic
1135138334 16:19901153-19901175 ATATCCAAACCACAGCAGAAGGG - Intergenic
1141663084 16:85452288-85452310 TTACCCAACCCTCATGAGCTGGG + Intergenic
1142712858 17:1732813-1732835 GTACCCAACAGGCAGGAGAAGGG - Exonic
1144391263 17:14795533-14795555 ATCCCTAACCCTCATGAGAGAGG - Intergenic
1145784881 17:27587340-27587362 ATAACCAACCTCCATGAGAAGGG - Intronic
1148567317 17:48641384-48641406 ATACCCATTCCCCAAGAGAAGGG - Intergenic
1150536008 17:66041867-66041889 ATACCCCACCCTCAAGAGCAGGG + Intronic
1151328298 17:73392061-73392083 ATAGCCTACCCTCAGGAGGGTGG - Intronic
1153414902 18:4835892-4835914 ATAGCCTACCCTTAAGAGAATGG + Intergenic
1154338768 18:13486327-13486349 ATTCCCAACTCTTTGGAGAAAGG - Intronic
1155263159 18:24064980-24065002 ATTCCCAACCCTAAGGAAAATGG + Intronic
1157453249 18:47803633-47803655 ATGCTCAATCCTAAGGAGAAGGG - Intergenic
1160012544 18:75116860-75116882 TTACCCATGCCTCAGGTGAAGGG + Intergenic
1160643363 19:162297-162319 ATACCTTATCCTCAGGAAAATGG + Intergenic
1164204073 19:23043431-23043453 ATACCCAATACACAGGAAAAAGG + Intergenic
1165402935 19:35613305-35613327 ATAACCCACTCCCAGGAGAAAGG + Intronic
1167412329 19:49352104-49352126 ATGACCAACACTCAGGAGATGGG + Intronic
925057607 2:867125-867147 ATCCCAAACCCTCAGCAAAATGG + Intergenic
926808086 2:16730925-16730947 ATACTCTATCATCAGGAGAATGG - Intergenic
927723923 2:25406141-25406163 ATAGCCAAACCTCAGAATAAGGG + Intronic
928766470 2:34652303-34652325 CTAATCAACTCTCAGGAGAACGG - Intergenic
928819458 2:35343019-35343041 ATACCCAACAGCCAGGAGACAGG + Intergenic
931761108 2:65417596-65417618 TTACTGAACCCTCAGGAGATAGG - Intronic
933244486 2:79960190-79960212 TTCCCCAACCTTCAAGAGAATGG - Intronic
933378296 2:81509593-81509615 ATACCCAACATTCATGAGGAGGG + Intergenic
934153578 2:89173481-89173503 CTCACCAACCATCAGGAGAATGG - Intergenic
934213658 2:90008451-90008473 CTCACCAACCATCAGGAGAATGG + Intergenic
935224075 2:101038211-101038233 ATCCTCAAACCTCAGGAGCAGGG + Intronic
936069075 2:109353425-109353447 ACACCTACCTCTCAGGAGAAAGG - Intronic
936134356 2:109876745-109876767 ATCCCAAACCCACCGGAGAAGGG + Intergenic
936210341 2:110494740-110494762 ATCCCAAACCCACCGGAGAAGGG - Intergenic
936434928 2:112496133-112496155 ATCCCAAACCCACAGGAGAAGGG - Intronic
937225194 2:120364772-120364794 ATATCCAACAATAAGGAGAAAGG - Intergenic
938216509 2:129522395-129522417 AAACCCCACCCACAGGGGAAAGG - Intergenic
938385769 2:130865918-130865940 ACATGCATCCCTCAGGAGAATGG - Intronic
939096648 2:137840040-137840062 ATACTCAATACTCAAGAGAAGGG + Intergenic
942659243 2:178246557-178246579 AGACCGTAACCTCAGGAGAAAGG - Intronic
943226575 2:185185891-185185913 ATAGACAACTCTCAGAAGAAGGG - Intergenic
944534380 2:200695112-200695134 ATTCCCATCCCTCAGGAGCAAGG - Intergenic
945949070 2:216021598-216021620 ATTCCCAAGCCTCTGGAAAAGGG - Intronic
946438450 2:219675131-219675153 CTCCCCAAAACTCAGGAGAAAGG - Intergenic
1170422702 20:16208434-16208456 ATAAGCAGGCCTCAGGAGAATGG + Intergenic
1170570305 20:17628781-17628803 ATGCCCAGCCCTCTGGAGCAGGG + Intronic
1173207344 20:41005489-41005511 ATAAACAACCCTCAGAAGGAGGG + Intergenic
1174210727 20:48875953-48875975 ATAACCAACCCCCAGGTGAACGG - Intergenic
1174437690 20:50522726-50522748 ATACCTTTCCCTCTGGAGAAAGG - Intronic
1174441802 20:50561520-50561542 ATACTAAACCCTGAGGCGAAAGG - Intronic
1175774725 20:61645920-61645942 ATCCACCACCCTCAGGAGGAAGG - Intronic
1178881580 21:36454216-36454238 ATAGAAAGCCCTCAGGAGAAAGG + Intergenic
1179113948 21:38472711-38472733 ATTCCCAAATCACAGGAGAAGGG + Intronic
1179214858 21:39358693-39358715 ATAACCATCCCCAAGGAGAAGGG - Intergenic
1179732796 21:43376740-43376762 ATTCCCTACCCTCAGGGAAAGGG - Intergenic
1180857474 22:19057614-19057636 CCACCCAACACCCAGGAGAAAGG + Intronic
1181109486 22:20592976-20592998 ATACCCAACCCAAGGGAGGAAGG + Intergenic
1181111871 22:20607126-20607148 CTCCCCACCCGTCAGGAGAAGGG - Intergenic
1183492074 22:38122113-38122135 ATACCCCAGCCTCAGGAGCAGGG - Intronic
952868760 3:37878135-37878157 ATACCTCACACTCATGAGAATGG - Intronic
952877441 3:37958288-37958310 AAACCCAACCCTCAGGCACATGG - Intronic
953103653 3:39854854-39854876 AAACCCCACCCCTAGGAGAAGGG - Intronic
954558941 3:51539341-51539363 ATTCCCAGACCTCAGGAGAGGGG - Intergenic
955852906 3:63240408-63240430 ATTCCCTACACTCATGAGAAGGG + Intronic
958166510 3:89884221-89884243 ATGCACAAGCCTCAGTAGAAAGG - Intergenic
958733148 3:97979801-97979823 CTCCCCAACCCTCAGCAGATGGG + Intergenic
961132822 3:124484624-124484646 ATACCCATTTCTCAGGAGAGAGG - Intronic
961414034 3:126744478-126744500 ATAGCCAACACACAGGAGATAGG - Intronic
965796008 3:172439327-172439349 AGACCCAACTCTAAGGACAAGGG - Intergenic
966896252 3:184447417-184447439 AGACACACCCCTCAGGAGAGGGG - Intronic
969390221 4:6887176-6887198 ATAACCAACCCTTAGGAGAGAGG - Intergenic
974384933 4:61191945-61191967 ATACCCAACCCACATAGGAAAGG - Intergenic
975505812 4:75135629-75135651 ATGCCCTACCCTCTGGGGAATGG + Intergenic
980110616 4:128633366-128633388 TTCCCCAACCCTGAGGAGATAGG - Intergenic
986659001 5:10042285-10042307 AAACCCAACCAACAGGACAAGGG + Intergenic
986840299 5:11688701-11688723 AAACCCACCACCCAGGAGAAGGG + Intronic
987220392 5:15784994-15785016 ACACCCAACCCTCAGATGAATGG - Intronic
991958277 5:72017166-72017188 ATCCCCAACTCTCTGGAGACAGG + Intergenic
994821031 5:104651425-104651447 ATAGCCAACACTCTGGAGAATGG - Intergenic
995580642 5:113597745-113597767 GTAACCAACCCTGAGGATAAGGG + Intergenic
997167224 5:131674173-131674195 GTACCCAACCCTCTAGGGAATGG - Intronic
998705703 5:144757487-144757509 AGACCCAATCATCAGGAGAGGGG + Intergenic
999391875 5:151199190-151199212 ATTCCCATCCCTCAGAGGAAGGG - Intronic
999525712 5:152404064-152404086 ATACCTCACCCCCAGGAAAATGG - Intronic
1002113997 5:176943119-176943141 TTACACATGCCTCAGGAGAAGGG - Intronic
1002751034 6:111945-111967 ATACCTTATCCTCAGGAAAATGG + Intergenic
1007105242 6:39279260-39279282 ATCCCCATCTTTCAGGAGAAAGG - Intergenic
1007766363 6:44162607-44162629 GCACCCCACCCTCAGGGGAATGG + Intronic
1010378566 6:75202554-75202576 ATGGACAAACCTCAGGAGAAAGG + Intronic
1015380188 6:132558467-132558489 GAAACCAACACTCAGGAGAAGGG + Intergenic
1015409632 6:132878403-132878425 ATACCCAGTACACAGGAGAAAGG + Intergenic
1019237757 6:170634495-170634517 ATACCTTATCCTCAGGAAAATGG - Intergenic
1024118542 7:46214876-46214898 AGACCCAACTCTCAGGCCAAGGG - Intergenic
1030834841 7:114269784-114269806 ACACCCCACCCTCAGTAAAAAGG + Intronic
1031439189 7:121772330-121772352 AGACCCAAACCTCTGGAGTAGGG + Intergenic
1034328230 7:150257666-150257688 ATGCCCAATACTCAGCAGAATGG + Intronic
1034764986 7:153711798-153711820 ATGCCCAATACTCAGCAGAATGG - Intergenic
1035510011 8:172116-172138 ATACCTTATCCTCAGGAAAATGG + Intergenic
1036235563 8:7036532-7036554 ATGCCCAGACCTCAGGAGAAGGG - Intergenic
1036237018 8:7047768-7047790 ACACCCAGAGCTCAGGAGAAGGG - Intergenic
1041409577 8:57538227-57538249 AAACCTAACCCTCAGAAAAATGG - Intergenic
1043411491 8:80002112-80002134 ATATCCAGCTCTCAGGAGAGAGG + Intronic
1043469152 8:80544812-80544834 ATACCTAAGACTCTGGAGAAGGG + Intergenic
1049645993 8:143735835-143735857 CTACCCACCCCCCAGGAGAATGG + Intergenic
1051329643 9:16010758-16010780 AAACCCAAACCTCTGGAGCATGG + Intronic
1056888797 9:90470013-90470035 AAACCCAACCCTCTGCAGAAAGG - Intergenic
1057819657 9:98321398-98321420 GTACCCCACCCTCAGCAGGATGG + Intronic
1058478819 9:105369971-105369993 ATATTCAACCCCCAGGAGCAAGG - Intronic
1059982721 9:119790863-119790885 AGTTCCAACCCTCAGGAGGAAGG + Intergenic
1062757964 9:138314792-138314814 ATACCTTATCCTCAGGAAAATGG - Intergenic
1191988040 X:67003152-67003174 ATCCCCAAACCTCAGAAGTAGGG + Intergenic
1195606314 X:106809550-106809572 ATACTCAACACCCAGGACAAGGG - Intronic
1196020877 X:110989798-110989820 TAACTCAACCCTCAGCAGAAGGG - Intronic
1196493249 X:116292770-116292792 ATAACCATCCCCAAGGAGAAGGG - Intergenic
1197595589 X:128460082-128460104 ATAGCAAATCCCCAGGAGAAGGG + Intergenic
1199711715 X:150474190-150474212 CCCCCCAACTCTCAGGAGAATGG - Intronic
1199740265 X:150729037-150729059 ATACTCAAGCGTCATGAGAAAGG - Intronic