ID: 916667052

View in Genome Browser
Species Human (GRCh38)
Location 1:166975788-166975810
Sequence TCCCGAGCGCGGGCGTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 42}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916667052_916667061 1 Left 916667052 1:166975788-166975810 CCCAGGGACGCCCGCGCTCGGGA 0: 1
1: 0
2: 0
3: 8
4: 42
Right 916667061 1:166975812-166975834 CCCGGGCGAGAACGCTGGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 87
916667052_916667065 14 Left 916667052 1:166975788-166975810 CCCAGGGACGCCCGCGCTCGGGA 0: 1
1: 0
2: 0
3: 8
4: 42
Right 916667065 1:166975825-166975847 GCTGGCTGGGGACTCGAGCAGGG 0: 1
1: 0
2: 1
3: 16
4: 187
916667052_916667064 13 Left 916667052 1:166975788-166975810 CCCAGGGACGCCCGCGCTCGGGA 0: 1
1: 0
2: 0
3: 8
4: 42
Right 916667064 1:166975824-166975846 CGCTGGCTGGGGACTCGAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 112
916667052_916667059 0 Left 916667052 1:166975788-166975810 CCCAGGGACGCCCGCGCTCGGGA 0: 1
1: 0
2: 0
3: 8
4: 42
Right 916667059 1:166975811-166975833 ACCCGGGCGAGAACGCTGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 42
916667052_916667058 -4 Left 916667052 1:166975788-166975810 CCCAGGGACGCCCGCGCTCGGGA 0: 1
1: 0
2: 0
3: 8
4: 42
Right 916667058 1:166975807-166975829 GGGAACCCGGGCGAGAACGCTGG 0: 1
1: 0
2: 0
3: 5
4: 64
916667052_916667066 15 Left 916667052 1:166975788-166975810 CCCAGGGACGCCCGCGCTCGGGA 0: 1
1: 0
2: 0
3: 8
4: 42
Right 916667066 1:166975826-166975848 CTGGCTGGGGACTCGAGCAGGGG 0: 1
1: 0
2: 2
3: 20
4: 277
916667052_916667063 2 Left 916667052 1:166975788-166975810 CCCAGGGACGCCCGCGCTCGGGA 0: 1
1: 0
2: 0
3: 8
4: 42
Right 916667063 1:166975813-166975835 CCGGGCGAGAACGCTGGCTGGGG 0: 1
1: 0
2: 0
3: 2
4: 95
916667052_916667067 30 Left 916667052 1:166975788-166975810 CCCAGGGACGCCCGCGCTCGGGA 0: 1
1: 0
2: 0
3: 8
4: 42
Right 916667067 1:166975841-166975863 AGCAGGGGAGCCTGTGTCTGCGG 0: 1
1: 0
2: 6
3: 54
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916667052 Original CRISPR TCCCGAGCGCGGGCGTCCCT GGG (reversed) Intronic
900096682 1:942729-942751 TCCGGAGCCCGGGGGCCCCTGGG - Exonic
900537708 1:3187087-3187109 TCAGGAGAGAGGGCGTCCCTGGG + Intronic
902520173 1:17011520-17011542 TCCCCAGCCCCGGCGTCTCTGGG + Intronic
902916861 1:19644618-19644640 TCCCCAGCGCCGGCGTCCGGAGG - Intronic
904773317 1:32893102-32893124 CACCGAGCGCGGGCCGCCCTGGG + Intronic
905813417 1:40929799-40929821 TCCCGAGCCCGGGCTTACATGGG + Intergenic
906403344 1:45521729-45521751 ACCCGAGCGCGGGCGGGCCCCGG + Exonic
915272142 1:154760837-154760859 TCGCGGGCGCGCGCCTCCCTTGG - Intronic
916667052 1:166975788-166975810 TCCCGAGCGCGGGCGTCCCTGGG - Intronic
921389729 1:214606131-214606153 TCCCGCCAGCGGGCGTCCCCGGG + Intronic
923630945 1:235649428-235649450 ACCCGCGCGCGGGCTTCCCCGGG + Intronic
1070198009 10:74176721-74176743 CCCCGCGCGCGGGCGGCCCCTGG - Intronic
1070570725 10:77637963-77637985 CCCCGGGCGCGGGCGGCCCGCGG - Intronic
1074815205 10:117137434-117137456 TCCAGAGCGCGGGAGTCCCCTGG + Intronic
1076657945 10:132036854-132036876 TCCCGAGGGAGGGGGTCCCGCGG + Intergenic
1096749829 12:53751683-53751705 TGCGGAGCGGGGGCGTCCCGGGG + Intergenic
1096777614 12:53973783-53973805 TCCCGAGGCCGGGGGTGCCTCGG - Exonic
1102930288 12:116856737-116856759 TCACGAGCGTGGGGGTCCCATGG + Exonic
1102961157 12:117094117-117094139 GCCCGAGCGAAGGCGTCCCGGGG - Intronic
1113541958 13:111115764-111115786 TCCCGAGCGCGGCCGGCCTCAGG - Intronic
1118808928 14:69260060-69260082 CCCCGAGCGCGCGCGTCCCCCGG - Exonic
1119383019 14:74240504-74240526 CCCCGAGCCCGCGCGTCCCCGGG - Intronic
1123739943 15:23226442-23226464 TCCCGCCAGCGGGCGTCCCCGGG + Intergenic
1124291167 15:28455410-28455432 TCCCGCCAGCGGGCGTCCCCGGG + Intergenic
1137555046 16:49465130-49465152 GCCTGAGCGCGGGGTTCCCTCGG + Intergenic
1146438836 17:32876589-32876611 TCCCGAGAGCGGACGCCCCTGGG - Intronic
1163172314 19:15540748-15540770 TCCCGAGGGCTGGCCTCCCGAGG + Intronic
930798698 2:55420047-55420069 TCCCGAGCGAGCGCGCCCCCGGG + Intergenic
932699785 2:73984856-73984878 TCCCGGGCGGGGGAGTCCCCGGG + Intergenic
941987622 2:171523575-171523597 TCCCGAGCAGAGGCATCCCTCGG - Intronic
944547316 2:200811520-200811542 GCCCGAGGGCGGGGGGCCCTCGG - Intronic
947992248 2:234497001-234497023 CCCGGAGCGCGGGCTTCCCCGGG + Exonic
1172702723 20:36863033-36863055 ACCCGAGCGCGGACGGCCCTTGG + Exonic
1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG + Exonic
1181058940 22:20272819-20272841 TCCGGAAGGCGGGGGTCCCTGGG + Intronic
1184656229 22:45943513-45943535 TCCCGAGGGCAGGCCACCCTGGG - Intronic
966712008 3:182980693-182980715 CCCCGGGCGCGGGGGTCCCCCGG + Intronic
968187019 3:196639885-196639907 TCCCGCGTGGGGGCGTCCCCGGG + Intronic
969288334 4:6222211-6222233 TCCCCAGTGAGGGCGTCCCTGGG + Intergenic
982484756 4:155953689-155953711 TACCGAGCGCGCGCCTCCCCGGG - Intronic
985639916 5:1058782-1058804 TGCCGAGAGCGGGCAGCCCTTGG - Intronic
989147057 5:38259017-38259039 CCCCGAGCCCGGGCGGCGCTAGG + Intronic
1004722204 6:18277460-18277482 CCCCGAGCGCGCGCGCGCCTTGG + Intergenic
1006502065 6:34465677-34465699 TCCCGAGCCTCGGCGTCCCTTGG - Intergenic
1019336407 7:485012-485034 CCTCGAGCGCGGGGGACCCTGGG - Intergenic
1049557607 8:143290980-143291002 TCCCGAGCGTGGGCTTCCTTGGG - Intronic
1049663115 8:143829243-143829265 CCATGAGCGCGGGCGGCCCTCGG - Intronic
1056406653 9:86282086-86282108 TCCCGGGGGTGGGCGTCCCCGGG - Intronic
1057849772 9:98556332-98556354 TCTCGAGCCCCGGTGTCCCTGGG - Intronic
1061860343 9:133464750-133464772 TCCCCAGCGTGGGCTTCCCCTGG + Intronic
1186513764 X:10150640-10150662 TCCCGAGCGTGGCTGACCCTCGG + Intergenic