ID: 916667694

View in Genome Browser
Species Human (GRCh38)
Location 1:166981483-166981505
Sequence ATGTGTGTAGAGAGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1266
Summary {0: 1, 1: 0, 2: 21, 3: 149, 4: 1095}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916667687_916667694 13 Left 916667687 1:166981447-166981469 CCCTTATGTCAAATAGCTTACAT 0: 1
1: 0
2: 0
3: 21
4: 221
Right 916667694 1:166981483-166981505 ATGTGTGTAGAGAGGGAGGGAGG 0: 1
1: 0
2: 21
3: 149
4: 1095
916667686_916667694 14 Left 916667686 1:166981446-166981468 CCCCTTATGTCAAATAGCTTACA 0: 1
1: 0
2: 0
3: 12
4: 144
Right 916667694 1:166981483-166981505 ATGTGTGTAGAGAGGGAGGGAGG 0: 1
1: 0
2: 21
3: 149
4: 1095
916667688_916667694 12 Left 916667688 1:166981448-166981470 CCTTATGTCAAATAGCTTACATT 0: 1
1: 0
2: 1
3: 27
4: 239
Right 916667694 1:166981483-166981505 ATGTGTGTAGAGAGGGAGGGAGG 0: 1
1: 0
2: 21
3: 149
4: 1095

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916667694 Original CRISPR ATGTGTGTAGAGAGGGAGGG AGG Intronic
900078184 1:834944-834966 ATGGGTGGATGGAGGGAGGGAGG - Intergenic
900298778 1:1966190-1966212 ATGAGTGTGGAGAGGGAGGCGGG + Intronic
900515631 1:3080934-3080956 GTGTGTGTAGAGGGGGTGGCGGG + Intronic
900882938 1:5394796-5394818 ATGGACGGAGAGAGGGAGGGAGG + Intergenic
901445567 1:9305937-9305959 ATGAGTGCAGAGAGGCAGGAGGG + Intronic
901634610 1:10664811-10664833 AGGTGGGGAGGGAGGGAGGGAGG - Intronic
902517551 1:16997452-16997474 ATGTGTGCAGTGGGGCAGGGTGG + Intronic
902609521 1:17588892-17588914 GTGTGTGTAGTGGGGGAGGTTGG + Intronic
902659866 1:17893463-17893485 AGGTGAGTGGAGAGGAAGGGAGG - Intergenic
902727545 1:18347165-18347187 CTGTGTTCAGAGAGGGAGGGAGG - Intronic
903188494 1:21642861-21642883 GTGTGTGTAGTGGGGAAGGGAGG - Intronic
903313656 1:22482390-22482412 ATGTGTGGAGAATGGGAGTGGGG - Intronic
903331552 1:22599592-22599614 GGGAGTGGAGAGAGGGAGGGAGG + Intronic
903552547 1:24168073-24168095 ATGTGTGGATAGAGAGATGGAGG - Intronic
903565977 1:24266178-24266200 ATGGATGGATAGAGGGAGGGTGG + Intergenic
903812186 1:26040918-26040940 ATGTTTGTAGAGATGGGGGGGGG - Intronic
904338120 1:29810968-29810990 ATGTGTGAGGCGAAGGAGGGTGG + Intergenic
904392518 1:30195372-30195394 ATGTGAGAAGAGAAGGAGGAAGG - Intergenic
904560755 1:31395602-31395624 TTCTGAGTAGAGAGGAAGGGTGG + Intergenic
904876847 1:33661928-33661950 GTGTGTGGTGGGAGGGAGGGGGG - Intronic
905427180 1:37895498-37895520 CTGTGGGGAGAGAGAGAGGGAGG - Intronic
905448080 1:38040353-38040375 ATGAGTGGAGAGAGAGAGAGAGG + Intergenic
906532968 1:46533861-46533883 AAGTGAGGAGAGAGGGAGGATGG - Intergenic
906652043 1:47519755-47519777 GTGTGGGCAGGGAGGGAGGGTGG + Intergenic
907076346 1:51582659-51582681 GTGAGTGTAGAGAAGGAGGGAGG - Intronic
907477386 1:54714780-54714802 ATATGTGGAGAGAGGCATGGAGG - Intronic
907499134 1:54865790-54865812 AGGTGGGAAGGGAGGGAGGGAGG - Intronic
907856154 1:58305981-58306003 ATGTGTGTGGAGGGGGGTGGGGG - Intronic
907954828 1:59218115-59218137 GTGTGTATAGAGAGTGAGAGAGG + Intergenic
908122749 1:61001358-61001380 ATGTGTATTGTGAGGGAGGGAGG - Intronic
908251796 1:62271683-62271705 AGGTGTGTGGAGAGGTAAGGAGG + Intronic
908682815 1:66681800-66681822 GTGTGGGGAGTGAGGGAGGGAGG - Intronic
908682817 1:66681804-66681826 ATTTGTGTGGGGAGTGAGGGAGG - Intronic
908782693 1:67706060-67706082 ATGTGTGTACAGACAGAAGGAGG + Intronic
908879062 1:68710267-68710289 AGCAGTGTAGAGAGGGAAGGTGG + Intergenic
909573306 1:77142779-77142801 ATGTGTGGAGAGAAGGAGGAAGG - Intronic
909652510 1:77991574-77991596 GTGTGTGTAGAGATGGTGGGAGG - Intronic
910283421 1:85526867-85526889 AAGTGAGAAGAGAAGGAGGGAGG + Intronic
911276418 1:95864977-95864999 TTGTGGGGAGAGAGGAAGGGAGG - Intergenic
911750622 1:101492923-101492945 ATTTTTGTAGAGATGGCGGGTGG + Intergenic
912308496 1:108595504-108595526 TTGTATGGAGAAAGGGAGGGAGG + Intronic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912596401 1:110881228-110881250 AGGTGAGTAGAGAGGGAGCAGGG - Intronic
912897472 1:113608219-113608241 AAGAGGGAAGAGAGGGAGGGAGG + Intronic
913064338 1:115236346-115236368 ATGTGTCTTGAGAGGGAGATGGG + Intergenic
913429721 1:118777174-118777196 ATATGTGTAGAAAGGAGGGGAGG + Intergenic
913476926 1:119246550-119246572 AAGTGTGGAGAGAGGGTGGCTGG - Intergenic
914206594 1:145536121-145536143 AAGTGAGAAGAGAAGGAGGGAGG - Intergenic
914328619 1:146645545-146645567 AGGTGGGGGGAGAGGGAGGGAGG - Intergenic
914806312 1:150994752-150994774 CTGTGTGCAGGGAGTGAGGGTGG - Intronic
914835154 1:151200409-151200431 ATGTGTGTCGGGTGGGGGGGCGG + Intronic
915074482 1:153297336-153297358 GTGTGAGCAGAGAGGGGGGGTGG + Intergenic
915091376 1:153428659-153428681 ATGTGTGGGCAGAGGGAGGAGGG + Intergenic
915587439 1:156851865-156851887 GTGAGTGTAGGGAGGGTGGGGGG - Intronic
916173261 1:162017643-162017665 ATTTGTGTAGACAGGGATGTAGG + Intronic
916505529 1:165425097-165425119 ATGTCTGTACAGAGGGATTGGGG - Intronic
916667694 1:166981483-166981505 ATGTGTGTAGAGAGGGAGGGAGG + Intronic
916848001 1:168672948-168672970 AGGTATGTAGTGAGGGAGGAGGG - Intergenic
916901595 1:169230186-169230208 ATGTGTGTATAGGTGTAGGGGGG - Intronic
917064239 1:171074221-171074243 AGGTGAGAAGGGAGGGAGGGAGG + Intergenic
917194526 1:172451258-172451280 AAGTGAGTAGAGAGAGAGTGGGG - Intronic
917711380 1:177688675-177688697 CTGTGGGAAGTGAGGGAGGGTGG + Intergenic
917833647 1:178921504-178921526 ATGTGTGTGGGGAGGGGGTGGGG + Intronic
917981110 1:180269998-180270020 ATGTGTGTACACAGTGAGGGGGG - Intronic
918038364 1:180896989-180897011 ATGAAGGAAGAGAGGGAGGGAGG + Intergenic
918170197 1:181989102-181989124 ATGAGAGTAATGAGGGAGGGTGG - Intergenic
918357154 1:183715752-183715774 ATACATGTAGAAAGGGAGGGAGG + Intronic
918819902 1:189239685-189239707 ATGTGTGTACAGATTGAGGTAGG + Intergenic
919347987 1:196411010-196411032 AGGTGGGAAGGGAGGGAGGGAGG - Intronic
919754929 1:201060857-201060879 GTGGGTGTGGAGAGGGAGGGAGG - Intronic
919813194 1:201421826-201421848 GTGTGTGAAGGGTGGGAGGGAGG - Intronic
919935111 1:202246022-202246044 ATGGATGGAGGGAGGGAGGGAGG - Intronic
919935178 1:202246221-202246243 ATGGAAGGAGAGAGGGAGGGAGG - Intronic
919935224 1:202246342-202246364 ATGGAAGGAGAGAGGGAGGGAGG - Intronic
920294151 1:204945683-204945705 ATGTGCACAGGGAGGGAGGGAGG + Intronic
920558008 1:206918353-206918375 GTGAGGGGAGAGAGGGAGGGAGG - Intronic
920598911 1:207302569-207302591 AGGTGTATTGAGAGGAAGGGTGG + Intergenic
921046963 1:211484748-211484770 AGGTGGGAAGAGAGGGAGGCAGG - Intronic
921189405 1:212696505-212696527 ATGTGTGTTGAGTGGAAAGGGGG + Intronic
921332838 1:214057237-214057259 TTGTGTCTAAAGAGGAAGGGAGG + Intergenic
921347881 1:214205705-214205727 ATGTGTGTATATACAGAGGGAGG + Intergenic
921454601 1:215353755-215353777 GTGTGTGTAAAGAGAGAGAGAGG + Intergenic
921650792 1:217675152-217675174 AGGTTTGTAGAGAAGGAGGATGG + Intronic
922073527 1:222219981-222220003 AAGTGTGTTGAGAGAGAAGGTGG - Intergenic
922083184 1:222318213-222318235 ATGCATGTGGAGAAGGAGGGCGG - Intergenic
922108492 1:222533426-222533448 ATGTGTGTATGGGGGCAGGGTGG + Intronic
923046563 1:230360363-230360385 ACCTGTGGAGGGAGGGAGGGAGG + Intronic
923290290 1:232538685-232538707 GTGTGTATAGTGGGGGAGGGGGG - Intronic
923290292 1:232538687-232538709 ATGTGTGTATAGTGGGGGAGGGG - Intronic
923608198 1:235464493-235464515 ATGTGGGAAGTGAGGGAGGGAGG - Intronic
1063001855 10:1932235-1932257 CTATCTGTAGAGAGGGAGGGAGG + Intergenic
1063667654 10:8073868-8073890 ATGTGTCTGGAGAGGGCGGCCGG - Exonic
1064769758 10:18711373-18711395 AGGTGTGTAGAGGGAGGGGGAGG - Intergenic
1064963248 10:20989557-20989579 GTGTGAGAAGACAGGGAGGGAGG + Intronic
1065135738 10:22667911-22667933 GTGTGTAGAGAGGGGGAGGGAGG + Intronic
1065383839 10:25115138-25115160 ATGGAGGGAGAGAGGGAGGGAGG - Intergenic
1065383870 10:25115219-25115241 ATGGAGGGAGAGAGGGAGGGAGG - Intergenic
1065383901 10:25115300-25115322 ATGGAGGGAGAGAGGGAGGGAGG - Intergenic
1065763935 10:29009006-29009028 AAGTGTGGTGAGAGAGAGGGTGG + Intergenic
1066235247 10:33479504-33479526 AGGTGTGTTTAAAGGGAGGGAGG - Intergenic
1066376485 10:34861905-34861927 ATGCCTGGAGAGAGAGAGGGCGG - Intergenic
1066558007 10:36636649-36636671 AGGGATGGAGAGAGGGAGGGAGG + Intergenic
1067253694 10:44613371-44613393 GTGTGTGTGGAGAGAGAGAGAGG + Intergenic
1067517408 10:46963580-46963602 ATGTGTGTACAGAGGGATGAGGG + Intronic
1067521512 10:47010619-47010641 CAGTGGGGAGAGAGGGAGGGAGG - Intergenic
1067644840 10:48088249-48088271 ATGTCTGTACAGAGGGATGAGGG - Intergenic
1067809382 10:49415587-49415609 ATGTGTCTGGAGAGAGAGAGAGG + Intergenic
1067964472 10:50893914-50893936 GTGTGTGTGGAGAGAGAGAGAGG - Intergenic
1068561512 10:58519929-58519951 ATGTGTGGACAGTGGGAGGAGGG - Intronic
1069157284 10:65046796-65046818 AAGTGTGTAGAGTGGGAGGAGGG + Intergenic
1069171455 10:65235067-65235089 GTGTGTGTGGAGAGAGAGAGAGG + Intergenic
1069582812 10:69576898-69576920 AATTGTGCAGGGAGGGAGGGGGG + Intergenic
1070043610 10:72807640-72807662 GTGTGAGAGGAGAGGGAGGGTGG - Intronic
1070147577 10:73785888-73785910 ATGTTTGCAGAGTGGGAGGACGG + Exonic
1070469682 10:76766480-76766502 CTGTGTGAAGAAAGGAAGGGAGG + Intergenic
1070499294 10:77055451-77055473 ATGGATGGAGGGAGGGAGGGAGG - Intronic
1071049840 10:81433359-81433381 ATGTGTGTAGACAGGGATGTGGG - Intergenic
1071139476 10:82491053-82491075 ATGGGTGTAGAGAAAGAGAGAGG - Intronic
1071362767 10:84866621-84866643 AGCTCTGTGGAGAGGGAGGGAGG + Intergenic
1071515284 10:86292916-86292938 CTGTGTGAAGAGATGGATGGGGG + Intronic
1071953898 10:90735836-90735858 ATTTTTGTAGAGATGGGGGGTGG - Intergenic
1072086474 10:92084537-92084559 ATGAGGGTAGAGAGGGAGATGGG - Intronic
1072107631 10:92289918-92289940 ATGTGTGTGGTGGGGGGGGGTGG + Intronic
1072271149 10:93778316-93778338 TTGTCTGTAGAGGGTGAGGGAGG - Intronic
1072804887 10:98418010-98418032 CTGTGTGCAGCGAGGGAGGACGG - Intronic
1073083985 10:100876797-100876819 AGGTGTGTAGAGTGGGGGTGGGG + Intergenic
1073345676 10:102781257-102781279 ATGACTGTGGAGAGGGAAGGGGG + Intronic
1073566053 10:104536597-104536619 AGGAGAGGAGAGAGGGAGGGAGG + Intergenic
1073753380 10:106555280-106555302 ATGTGTATAAATATGGAGGGAGG + Intergenic
1074162634 10:110846792-110846814 ATGAGTCTACAGAGAGAGGGAGG - Intergenic
1074204658 10:111272271-111272293 AAGTGGGGAGAGAGGGAGAGGGG + Intergenic
1074580184 10:114711729-114711751 AGCTGAGTGGAGAGGGAGGGGGG + Intergenic
1074607287 10:114985844-114985866 AGGTCTGAAGAGAGGGAGAGAGG + Intergenic
1074612426 10:115035018-115035040 GTGTGTCTAGAGAGAGAGGTGGG - Intergenic
1074763707 10:116685699-116685721 ATGTAGAAAGAGAGGGAGGGTGG + Intronic
1075908031 10:126099393-126099415 AGGTGGATAGAGAGGGAGGGAGG - Intronic
1076458228 10:130619450-130619472 ATGAGTGAAGAGAGGGAGACAGG - Intergenic
1076542024 10:131220552-131220574 ATGGGTTCAGAGAGGGAGGGAGG + Intronic
1076823254 10:132952563-132952585 AGGTGTGCAGAGAGAGAGGGCGG + Intergenic
1076857475 10:133124412-133124434 AGGTTTCTAGAAAGGGAGGGCGG - Intronic
1077366351 11:2162846-2162868 GAGTGTGTAGGGAGGGAGGCTGG + Intergenic
1077838271 11:5944446-5944468 ATGTGTATGGAGAGTGTGGGTGG + Intergenic
1077906870 11:6541098-6541120 CTGTGTGGAGAGAGGGAGGTGGG + Intronic
1077941334 11:6846694-6846716 ATATGTGAAGAGAGGCAGAGAGG - Exonic
1078040378 11:7856110-7856132 TGGTGGGGAGAGAGGGAGGGAGG - Intergenic
1078545407 11:12243421-12243443 AGGTGTGCTGTGAGGGAGGGAGG - Intronic
1078941700 11:16013638-16013660 ATGGGAGTAAAGAGGGAGGGAGG - Intronic
1079023587 11:16927975-16927997 TTGTGTGTGGAGGGGGAAGGGGG + Intronic
1079422092 11:20302987-20303009 GTGTGTGTAGAGAGAGAGAGAGG + Intergenic
1080255381 11:30284487-30284509 AAAGGTGGAGAGAGGGAGGGAGG + Intergenic
1080275517 11:30499174-30499196 ACATGTGTACAGAAGGAGGGAGG + Intronic
1080641420 11:34160683-34160705 GTGTGTGTTGAGTGGGGGGGGGG + Intronic
1080754693 11:35185573-35185595 ATGGATGGAGAGAGGGAGGGAGG - Intronic
1080885313 11:36362640-36362662 ATGGGTGGAGAGAAGAAGGGAGG - Intronic
1081003304 11:37701990-37702012 ATGAGTGTAGTGAGGTAGGCAGG - Intergenic
1081004015 11:37711159-37711181 ATGTGTGTGCAGGGGTAGGGTGG - Intergenic
1081230137 11:40576150-40576172 AGGTCTGTAGAGAGGGATGAAGG + Intronic
1081517947 11:43851843-43851865 ATGTGTGAAGAGTGGCAGGAGGG - Intronic
1081655824 11:44856833-44856855 AAGTGTGTAGGGAGGGAGGGAGG - Intronic
1082735862 11:56854952-56854974 AGGAGGGAAGAGAGGGAGGGAGG + Intergenic
1083142598 11:60734076-60734098 ATTTTTGTAGAGATGGCGGGTGG - Intronic
1083441409 11:62678956-62678978 GTGTGTGACGAGAAGGAGGGCGG + Exonic
1083516631 11:63265049-63265071 ATGAATCTAGAGAGGGAGGCAGG - Intronic
1083604883 11:63972540-63972562 GTGTTTGTAGAGCTGGAGGGGGG - Intergenic
1083960557 11:66012710-66012732 AGGTGGGGAGAGAGGGAGAGGGG - Intronic
1084144355 11:67256205-67256227 GTGTGTGGAGGGAGGGAGGGAGG + Exonic
1084368608 11:68721269-68721291 CTGTGGCAAGAGAGGGAGGGTGG - Intronic
1084431835 11:69115633-69115655 AGGTGTGTCCAGAGAGAGGGAGG + Intergenic
1084739926 11:71133133-71133155 ATGAGTGGATGGAGGGAGGGAGG + Intronic
1084859518 11:72009186-72009208 CTGTGGGCAGAGAGGGTGGGTGG + Intronic
1084906776 11:72354601-72354623 AGGTGTGGTGGGAGGGAGGGAGG - Intronic
1085737589 11:79052629-79052651 ATGTGGCGAGGGAGGGAGGGAGG + Intronic
1085841518 11:80016830-80016852 AAGTGAGAAGAGATGGAGGGAGG - Intergenic
1085881431 11:80471667-80471689 GTGTGTGTGGAGATGGGGGGGGG + Intergenic
1085970778 11:81587970-81587992 AGGAGGGGAGAGAGGGAGGGAGG + Intergenic
1086419422 11:86623909-86623931 ATGTGTGTGGGCAGGCAGGGAGG - Intronic
1086837488 11:91642911-91642933 GTGTGTGTAGAGAGAAAGAGAGG - Intergenic
1086906461 11:92423669-92423691 ATGTCTGTAGAGAGAGGGTGGGG + Intronic
1087313974 11:96584706-96584728 ATGTGTGTGGAGAGGGGATGAGG + Intergenic
1087666245 11:101052516-101052538 ATGTGTTTAGAGATGTAGGCTGG + Intronic
1088057476 11:105602798-105602820 ATGGATGGAGGGAGGGAGGGAGG - Intergenic
1089075987 11:115739158-115739180 ATGTGTACAGAGAGGGAGAGAGG + Intergenic
1089458564 11:118639766-118639788 GTTTGTGTAGTGAGGCAGGGAGG - Intronic
1089516451 11:119035349-119035371 ATTTTTGTAGAGATGGCGGGGGG - Intergenic
1089603706 11:119629570-119629592 ATGGGTGGACAGAGGCAGGGTGG + Intronic
1089792480 11:120954768-120954790 GTGTGTGTAGTGAGAGAGAGAGG - Intronic
1090513882 11:127404027-127404049 ATGTGTTTAGGGGTGGAGGGAGG - Intergenic
1090670616 11:128942773-128942795 AGGTGAGGAGAGGGGGAGGGAGG - Exonic
1091150792 11:133326606-133326628 ATGTGTGTACAGAGTGTGGGTGG + Intronic
1091323882 11:134669882-134669904 CTGTGTGTGCACAGGGAGGGGGG + Intergenic
1092113327 12:5980205-5980227 AGGTAGGTAGGGAGGGAGGGAGG + Intronic
1092549450 12:9482136-9482158 TTTTGTGAAGTGAGGGAGGGAGG - Intergenic
1092632247 12:10394661-10394683 GTCTGTGTAGAAAGGGAGGAAGG + Intronic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093487551 12:19667702-19667724 GTGTGTGTAGAGAGAGTGGGTGG + Intronic
1094227495 12:28062348-28062370 ATGTGTGTACAAACGCAGGGTGG - Intergenic
1094521814 12:31199005-31199027 TTTTGTGAAGTGAGGGAGGGAGG + Intergenic
1095095900 12:38149074-38149096 AAGGGAGTAGTGAGGGAGGGAGG - Intergenic
1095655909 12:44668703-44668725 ATGTGAGTAGTGATGGTGGGTGG - Intronic
1095758859 12:45804002-45804024 ATATATGAAGAGAGGGAGAGAGG + Intronic
1095858097 12:46884233-46884255 ATGAATTTAGAGAGGGAGGTAGG - Intergenic
1095942292 12:47735194-47735216 AGGTGTGCAGAAAGGGAGTGTGG - Intronic
1096179753 12:49544147-49544169 ATGCGGGGAGGGAGGGAGGGAGG - Intronic
1096418013 12:51430483-51430505 ATGTGTGAGGAGAGGGTGGAGGG - Intronic
1096567732 12:52495357-52495379 ATGTGTGTGGGGGAGGAGGGTGG + Intergenic
1097026067 12:56056503-56056525 AGGTGGTTAGAGAGGAAGGGAGG - Intergenic
1097402955 12:59151882-59151904 ATGTGTGTGGCGGGGGAGGGGGG - Intergenic
1097951155 12:65429464-65429486 ATGTGTTTGGAGAGGTAGGCAGG + Intronic
1098131424 12:67354456-67354478 ATGTGGGTTCAAAGGGAGGGTGG + Intergenic
1098998490 12:77149331-77149353 GTGTGTGTGTTGAGGGAGGGAGG - Intergenic
1099034871 12:77573727-77573749 GGGTGGGTAAAGAGGGAGGGAGG + Intergenic
1099118741 12:78661265-78661287 ATGTGTGTAGGGTGAAAGGGAGG + Intergenic
1099584222 12:84495508-84495530 AGGTTTGAAGAGAAGGAGGGAGG - Intergenic
1099620270 12:84995194-84995216 AGGTAGGTAGGGAGGGAGGGAGG + Intergenic
1099653881 12:85464642-85464664 GTGTGTGTAGAGAGAGAGAGAGG - Intergenic
1100056632 12:90519578-90519600 ATGTATGTGGAGAGGGAGGATGG - Intergenic
1100186631 12:92146091-92146113 TTGTGTCGAGGGAGGGAGGGAGG + Intergenic
1100449040 12:94687917-94687939 ATGTGTGTTGGAAGGGAGTGGGG - Intergenic
1100729938 12:97453790-97453812 ATGTTTGAAGAAATGGAGGGAGG - Intergenic
1100980081 12:100156831-100156853 ATCTTTGGAGAGAGGGAGGCAGG + Intergenic
1101000734 12:100355202-100355224 ATGTGTGGGGAGAAAGAGGGAGG + Intergenic
1101525307 12:105523211-105523233 AAGTGGGAACAGAGGGAGGGAGG + Intergenic
1101786321 12:107886704-107886726 ATGTGGATAAAGTGGGAGGGAGG + Intergenic
1101840722 12:108325742-108325764 GTGTGTTTAGAGAGGCAGGATGG - Intronic
1102388943 12:112534342-112534364 TTGTTTGTAGAGATGGGGGGTGG + Intergenic
1102420322 12:112798309-112798331 ATTTATTTAGAGAGCGAGGGGGG + Intronic
1102501179 12:113353630-113353652 AAGAGTGGAGGGAGGGAGGGAGG - Intronic
1102501188 12:113353654-113353676 AGGTAGGAAGAGAGGGAGGGAGG - Intronic
1102520181 12:113472902-113472924 GTGTGTGTTAAGGGGGAGGGGGG + Intergenic
1102754163 12:115323303-115323325 AGGTAGGTAGGGAGGGAGGGAGG + Intergenic
1102877977 12:116462446-116462468 AAGTGGGGAGAGAGAGAGGGAGG + Intergenic
1103084989 12:118055993-118056015 ATGAGAGTAGAGATGGAGAGGGG - Intronic
1103284956 12:119793074-119793096 TTGTGTGTGGTGGGGGAGGGGGG - Intronic
1103307116 12:119973917-119973939 AGGAGGGGAGAGAGGGAGGGAGG + Intergenic
1103948728 12:124540686-124540708 ATGGGGGTGGAGATGGAGGGGGG + Intronic
1104435539 12:128753362-128753384 ATGTGTGTTAACAGGGACGGGGG - Intergenic
1104661474 12:130613935-130613957 ATGACAGCAGAGAGGGAGGGAGG + Intronic
1104848720 12:131860794-131860816 ATGTGAGGGAAGAGGGAGGGAGG + Intergenic
1105211651 13:18260687-18260709 ATGAATGGATAGAGGGAGGGAGG + Intergenic
1105405362 13:20128329-20128351 CTCTGTGTAGACAGGGTGGGTGG + Intergenic
1105483600 13:20803687-20803709 ATGAGGGTGGAGAGGCAGGGAGG - Intronic
1105607317 13:21936902-21936924 GTGTGTGTAGAGAAGGTGGGTGG + Intergenic
1105770422 13:23606030-23606052 TTGTGTGTGGCGGGGGAGGGCGG + Intronic
1105836315 13:24215235-24215257 ATGTGTGCCAAGAGGCAGGGAGG + Intronic
1107211352 13:37858791-37858813 ATGGGGGTTGAGAGGGAGTGGGG + Intronic
1107375172 13:39796611-39796633 ACGGGGGCAGAGAGGGAGGGAGG + Intergenic
1107480182 13:40779700-40779722 TTGTTTGTAGAGAAGGGGGGGGG - Intergenic
1108165980 13:47693530-47693552 ATGAGGAAAGAGAGGGAGGGAGG - Intergenic
1108243644 13:48493276-48493298 GTGTGTGTGGAGAGAGAGAGAGG - Intronic
1108275420 13:48804470-48804492 ATGTGCTCAGTGAGGGAGGGAGG + Intergenic
1109205966 13:59483062-59483084 ATATATATAGAGAGAGAGGGGGG - Intergenic
1110994149 13:82084181-82084203 GTGTGTGTATAGAGAGAGAGAGG + Intergenic
1110994151 13:82084183-82084205 GTGTGTATAGAGAGAGAGAGGGG + Intergenic
1111542256 13:89684456-89684478 ATGAGTGTGGACAGGGATGGAGG + Intergenic
1111681492 13:91447039-91447061 ATGAGACTGGAGAGGGAGGGAGG + Intronic
1111823520 13:93242401-93242423 TTTTGTGTAGAGAGGGAGCAGGG + Intronic
1112164144 13:96899485-96899507 ATGTGTATGGAGGGAGAGGGTGG - Intergenic
1112795527 13:103052435-103052457 ATGTGTGTAGAGAGAGAGGTGGG - Intronic
1113072911 13:106438827-106438849 ATGGGTGGAGGGAGGAAGGGAGG + Intergenic
1113105041 13:106762700-106762722 ATGTGTGTTGAAGGTGAGGGTGG + Intergenic
1113233956 13:108248403-108248425 CTCTGTGGAGGGAGGGAGGGAGG + Intergenic
1113251538 13:108458524-108458546 AAGCGGGGAGAGAGGGAGGGAGG - Intergenic
1113615566 13:111678149-111678171 ATGTGTTGAGAGAGGGAGAGAGG - Intergenic
1113621034 13:111763051-111763073 ATGTGTTGAGAGAGGGAGAGAGG - Intergenic
1113674000 13:112195892-112195914 AGGAGGGGAGAGAGGGAGGGAGG - Intergenic
1113959676 13:114119690-114119712 CTGGCTGGAGAGAGGGAGGGGGG - Intronic
1113959689 13:114119727-114119749 CTGGCTGGAGAGAGGGAGGGGGG - Intronic
1114149791 14:20025156-20025178 ATGTATCTAGAGAGAGAGGAGGG - Intergenic
1114276871 14:21154622-21154644 AGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1114492821 14:23113852-23113874 ATCTGTGTAGAGGGGTGGGGAGG + Intergenic
1115409240 14:33053796-33053818 TTTTGGGTAGAGAGGAAGGGGGG - Intronic
1115890221 14:38018095-38018117 TTGTGTGTAGAGAGGGTTGGTGG + Intronic
1117451731 14:55857720-55857742 ATGTGTGGAGAGAGAGAGAGTGG + Intergenic
1117521316 14:56554049-56554071 GTGTGTGTTGTGGGGGAGGGGGG - Intronic
1118011168 14:61612036-61612058 GTGTGTGTGGAGGGGGTGGGAGG - Intronic
1118294390 14:64555845-64555867 GTGTGTGTAGAGAGAGAGAGGGG - Intronic
1118295675 14:64566706-64566728 ATGTGTGTGCAGAGGGAATGGGG - Intronic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1118441744 14:65818516-65818538 TTGTGTGTGGGGAGGGTGGGGGG - Intergenic
1118474751 14:66106175-66106197 ATGTTTGTATAGAGGGGTGGGGG + Intergenic
1118889606 14:69897139-69897161 ATGTGGGTTGAGAGGAGGGGGGG - Intronic
1119662184 14:76459922-76459944 AGATGGGGAGAGAGGGAGGGAGG + Intronic
1119895970 14:78220336-78220358 AGGTGTGCAGAGAGGGAGGAGGG + Intergenic
1119900656 14:78256822-78256844 ATTTGTTCAGAGAGGGTGGGAGG + Intronic
1120489438 14:85158096-85158118 ATGTGAGTAGAAATGGAGTGAGG - Intergenic
1120595725 14:86432946-86432968 ATCTGTGCAGGGTGGGAGGGTGG + Intergenic
1120635296 14:86943803-86943825 AGGAGGGGAGAGAGGGAGGGAGG - Intergenic
1120635324 14:86943916-86943938 AGGAGGGGAGAGAGGGAGGGAGG - Intergenic
1120795889 14:88632491-88632513 ATGAATGTAGAGAGGGATAGTGG - Intronic
1121014324 14:90539159-90539181 ATGTGGGTGGAGAGTGGGGGTGG + Exonic
1121242072 14:92438431-92438453 ATTTTTGTAGAGATGGCGGGGGG - Intronic
1121444740 14:93971372-93971394 ATGTGAGCAGAGAGGGCAGGGGG - Intronic
1121481397 14:94278580-94278602 ATGAAGGAAGAGAGGGAGGGTGG - Intronic
1121733538 14:96202750-96202772 ATGGATGGAGGGAGGGAGGGAGG + Intergenic
1121894508 14:97634014-97634036 ATTTGTGGAGGGAGGGAGGAAGG + Intergenic
1122021976 14:98845570-98845592 ATGTTTGAAGAGAGGGAGACAGG + Intergenic
1122364965 14:101189581-101189603 ATGTGGGTACATAAGGAGGGAGG + Intergenic
1122703345 14:103605063-103605085 AAGTGGGTGGAGAGGGGGGGTGG - Intronic
1122958448 14:105083555-105083577 ATGTGTGGATAGAGAGATGGTGG - Intergenic
1123177488 14:106435411-106435433 ATATATGTAGAGAGAGAGGAAGG + Intergenic
1123473759 15:20572536-20572558 ATCTTTGGAGAGAGGGAGGTGGG - Intergenic
1123644250 15:22427817-22427839 ATCTTTGGAGAGAGGGAGGCGGG + Intergenic
1123665558 15:22607714-22607736 ATCTTTGGAGAGAGGGAGGCAGG + Intergenic
1123734059 15:23167547-23167569 ATCTTTGGAGAGAGGGAGGCGGG - Intergenic
1123752198 15:23364938-23364960 ATCTTTGGAGAGAGGGAGGCAGG - Exonic
1124284562 15:28388858-28388880 ATCTTTGGAGAGAGGGAGGCGGG - Exonic
1124298135 15:28522756-28522778 ATCTTTGGAGAGAGGGAGGCGGG + Exonic
1124319389 15:28702128-28702150 ATCTTTGGAGAGAGGGAGGCAGG + Exonic
1124407143 15:29403294-29403316 ATGGGTTGAGAAAGGGAGGGGGG - Intronic
1124483130 15:30093303-30093325 ATCTTTGGAGAGAGGGAGGCAGG - Exonic
1124489579 15:30145371-30145393 ATCTTTGGAGAGAGGGAGGCAGG - Exonic
1124520451 15:30403914-30403936 ATCTTTGGAGAGAGGGAGGCGGG + Exonic
1124538206 15:30562305-30562327 ATCTTTGGAGAGAGGGAGGCGGG - Exonic
1124544671 15:30614365-30614387 ATCTTTGGAGAGAGGGAGGCAGG - Exonic
1124564631 15:30801795-30801817 ATCTTTGGAGAGAGGGAGGCGGG - Intergenic
1124651563 15:31477881-31477903 AGGTGGGTAGGGAGGGAGGGTGG + Exonic
1124656786 15:31515638-31515660 ATGGATGAAGAGAGAGAGGGAGG - Intronic
1124753948 15:32392956-32392978 ATCTTTGGAGAGAGGGAGGCAGG + Exonic
1124760447 15:32445280-32445302 ATCTTTGGAGAGAGGGAGGCGGG + Exonic
1124778189 15:32603782-32603804 ATCTTTGGAGAGAGGGAGGCGGG - Exonic
1124959021 15:34381612-34381634 ATCTTTGGAGAGAGGGAGGCGGG + Exonic
1125406221 15:39354835-39354857 ATGTGTGTAGAAATGAAGGTGGG - Intergenic
1126202065 15:45997781-45997803 TTGTGTGTGGAGAGGGATGGGGG - Intergenic
1126506824 15:49414392-49414414 GTGTGTGGGGGGAGGGAGGGGGG + Intronic
1126612676 15:50545454-50545476 ATGTTGGGAGAGAGGGAGGGAGG - Intronic
1126801162 15:52297757-52297779 ATGTGTGAATAGAGGTAAGGAGG + Intergenic
1127324725 15:57883956-57883978 ATGTGTGGGGAGTGGGAGGCAGG - Intergenic
1127732121 15:61811019-61811041 ATTTGTGGAGGGTGGGAGGGCGG - Intergenic
1128114085 15:65094586-65094608 AAGCGGGCAGAGAGGGAGGGAGG + Intronic
1128419039 15:67474096-67474118 GTGTGTGTGGAGAGGGAGAGAGG + Intronic
1128612441 15:69084764-69084786 ATGTGATTAGAGAGGGAAAGAGG - Intergenic
1128793413 15:70449151-70449173 ATGGATGGAGAGATGGAGGGAGG + Intergenic
1128793618 15:70449879-70449901 ATGAATGGAGAGAGGGATGGAGG + Intergenic
1128793626 15:70449903-70449925 ATGGGTGGATAGAGGGATGGAGG + Intergenic
1128838123 15:70827850-70827872 ATGTGTATGGAGCGGGAGGGAGG + Intergenic
1129238031 15:74235343-74235365 GTGGGGGTAGAGAGGGAGGCTGG + Intergenic
1129238227 15:74236510-74236532 ATGTGGGGGGAGGGGGAGGGTGG - Exonic
1129384091 15:75185978-75186000 AAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1129672271 15:77613933-77613955 ACGTGTGTAGAAGGGTAGGGAGG + Exonic
1129728299 15:77915310-77915332 ATCTTTGGAGAGAGGGAGGCGGG + Intergenic
1129848506 15:78778936-78778958 AGGTGTGGAGAGAGGCTGGGAGG + Intronic
1130368889 15:83266252-83266274 GTGTGGGGAGGGAGGGAGGGAGG + Intronic
1130372997 15:83302960-83302982 ATGTGTTTAGAGTTGGAGAGGGG + Intergenic
1130904070 15:88227753-88227775 AGGTGGGTAAAGGGGGAGGGAGG - Intronic
1131373490 15:91904042-91904064 ATCTGTGTTCAGCGGGAGGGAGG + Intronic
1131832333 15:96361645-96361667 GTGTGTGTTGAGGGGGAGCGGGG - Intergenic
1132628781 16:906049-906071 TTGTGTGTGGTGACGGAGGGGGG + Intronic
1132692495 16:1187865-1187887 ATGTTTCTACAGAGGGACGGAGG - Intronic
1132816504 16:1830903-1830925 GTGTGTGTATAGAGAGAGAGAGG - Intronic
1133468314 16:6049464-6049486 ATGAGACTAGAGAGGGAGAGTGG - Intronic
1133550371 16:6848615-6848637 ATGTGTGTAGAGAGAGATGATGG + Intronic
1133689548 16:8199993-8200015 ATGTGAGAAGAGAGGGAGGGAGG - Intergenic
1133883759 16:9807229-9807251 GTGGGGGGAGAGAGGGAGGGAGG + Intronic
1134329002 16:13233273-13233295 ATGAAGGAAGAGAGGGAGGGAGG + Intronic
1134329314 16:13235859-13235881 ATGGGGGTAGAGAATGAGGGAGG + Exonic
1134752288 16:16635595-16635617 GTGAGTGTAGAGCAGGAGGGAGG - Intergenic
1135257437 16:20952317-20952339 ATGTTTATGGTGAGGGAGGGAGG + Intronic
1135513679 16:23111338-23111360 ATGAATGTGGAGAGGGAGGAAGG + Intronic
1135583680 16:23650431-23650453 TGGTGTGTGGGGAGGGAGGGAGG - Intronic
1135728193 16:24873228-24873250 AGGAATGGAGAGAGGGAGGGAGG + Intronic
1136110394 16:28061085-28061107 GTGTGTGCACAGAGGAAGGGAGG + Intronic
1136246183 16:28977576-28977598 ATGAGTGTGGAGAGGTAGGCAGG + Intronic
1136248577 16:28989288-28989310 AGGGCTGTGGAGAGGGAGGGAGG - Intronic
1136449609 16:30346318-30346340 GTGTGTGTAGAGATGGAGTCTGG + Intergenic
1136938474 16:34498948-34498970 ATGAGAGAAGGGAGGGAGGGAGG - Intergenic
1136961345 16:34849609-34849631 ATGAGAGAAGGGAGGGAGGGAGG + Intergenic
1137218722 16:46426809-46426831 ATGAGAGAAGGGAGGGAGGGAGG - Intergenic
1137704066 16:50521740-50521762 ATGTGTCAAGTGAAGGAGGGTGG - Intergenic
1137790985 16:51174568-51174590 ATGAGTTTGGAGAGGGAGGCTGG - Intergenic
1138093697 16:54195938-54195960 AAGTGAGAAGAGAGGGAAGGAGG + Intergenic
1138170166 16:54841671-54841693 CTGTGTGTTGGGAGGAAGGGAGG + Intergenic
1138334010 16:56238105-56238127 ATGTGTGTGGGGCGGGCGGGGGG - Intronic
1138528365 16:57621495-57621517 ATGGGTGTAGGGAGTGGGGGTGG + Intronic
1139160335 16:64498365-64498387 ATGTGTGTGGGGAGGGAATGGGG + Intergenic
1139185522 16:64801659-64801681 GTGTGTGTAGCGGGGGAGCGTGG - Intergenic
1139341273 16:66269782-66269804 ATGCCTGGAGGGAGGGAGGGAGG + Intergenic
1139530419 16:67539913-67539935 ATGTGTGCAGAGTGGGGTGGGGG + Intronic
1139647866 16:68344919-68344941 GTGTGTGTAGAGATGCAGGAAGG - Intronic
1140004945 16:71065398-71065420 AGGTGGGGGGAGAGGGAGGGAGG + Intronic
1140031633 16:71344072-71344094 ATATATGTAGAGAGTGAGAGAGG + Intergenic
1140087714 16:71811286-71811308 ATGTGTGTAGGTAGGTAGGTAGG - Intergenic
1140200248 16:72889053-72889075 ATGGGTGGAGGGAGGGAGGGAGG + Intronic
1140281093 16:73555941-73555963 AAGTGTCTAGAGAGGGAGGGTGG + Intergenic
1140357067 16:74315550-74315572 ATGTGTGTGGGAAGGAAGGGTGG - Intergenic
1140865841 16:79061402-79061424 ATGTGTGCAGTGAGTGTGGGAGG + Intronic
1141314307 16:82946216-82946238 ATGAATGGAGGGAGGGAGGGAGG + Intronic
1141673292 16:85504135-85504157 ATGTGTGAAGAGAGGTTGCGTGG + Intergenic
1141728378 16:85805863-85805885 TGGTGAGTAGAGAGGGAGGAAGG + Exonic
1141790119 16:86228697-86228719 AGGTAGGTAGGGAGGGAGGGAGG - Intergenic
1141854945 16:86674343-86674365 ATGGATGAAGAGATGGAGGGAGG - Intergenic
1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG + Intronic
1143332878 17:6150344-6150366 GGGTGTGGAGAGAGGGAGGGAGG + Intergenic
1143769148 17:9156957-9156979 GTGGGTGGAGGGAGGGAGGGAGG - Intronic
1143964254 17:10745347-10745369 ATGTGTGGACAGAAGCAGGGGGG - Intergenic
1144322668 17:14145167-14145189 GTGTGTGTGGAGGGGCAGGGAGG + Intronic
1144439524 17:15268886-15268908 ATGGAAGGAGAGAGGGAGGGAGG + Intergenic
1144573710 17:16416165-16416187 GTGTGTGTAGAAAGGGTGGTGGG + Intronic
1144573904 17:16417109-16417131 AGGGGTGAGGAGAGGGAGGGAGG - Intronic
1144583748 17:16475314-16475336 GTGTGTGTGGAGAGAGAGGAAGG + Intronic
1144763270 17:17719296-17719318 ATGTGGGCAGAGAGGACGGGGGG - Intronic
1145318319 17:21748250-21748272 GTGTGTGTCGGGGGGGAGGGGGG - Intergenic
1145795202 17:27651414-27651436 GTGTGTGTGGCGGGGGAGGGGGG - Intergenic
1146422234 17:32698341-32698363 AGGGGGGAAGAGAGGGAGGGAGG - Intronic
1146639819 17:34531841-34531863 GTGTGTGTATAGATGGAGTGAGG - Intergenic
1146665391 17:34699167-34699189 ATGTGGATAGAGTGGGAGGAAGG + Intergenic
1146925255 17:36740066-36740088 AAGAGGGAAGAGAGGGAGGGAGG + Intergenic
1147170232 17:38614214-38614236 ATGTGTGTAAGGAAGGAAGGGGG - Intergenic
1147351547 17:39851063-39851085 ATATATATAGAGAGAGAGGGAGG + Intronic
1147445726 17:40474286-40474308 GTGGGAGAAGAGAGGGAGGGAGG + Intergenic
1147626911 17:41906452-41906474 ATGTGTGTAGCCTGGGTGGGTGG - Intronic
1148562066 17:48611966-48611988 ATGTGTGTCGGGAGGTGGGGTGG - Intronic
1148652730 17:49261193-49261215 ATGTGTGTGGGGAGTGTGGGTGG - Intergenic
1149037281 17:52149077-52149099 GTGTGTGTAGTGAGAGAGAGGGG + Intronic
1149117991 17:53122198-53122220 ATGTGTGTGTAGAGGGGTGGGGG + Intergenic
1149117993 17:53122200-53122222 GTGTGTGTAGAGGGGTGGGGGGG + Intergenic
1151039013 17:70836222-70836244 GTGTGTGTAGAGAGAGAGAGAGG - Intergenic
1151085875 17:71380070-71380092 ATGTGTGGTGAGAAGAAGGGGGG + Intergenic
1151129918 17:71886104-71886126 TTGGGGGTAGAGTGGGAGGGTGG + Intergenic
1151653023 17:75481591-75481613 ATGTGTGGAGACAGGCAGGAAGG + Intronic
1151784068 17:76266401-76266423 GTGTGTGTGGAGGGGGAGGGGGG - Intronic
1151882928 17:76905675-76905697 CTGGGTGGAGGGAGGGAGGGAGG - Intronic
1152026781 17:77815102-77815124 AAGTGGGGAGGGAGGGAGGGAGG - Intergenic
1152077158 17:78166807-78166829 ATGGAGGTAGAGAGGGACGGAGG + Intergenic
1152279386 17:79376363-79376385 GTGTGGGTGGAGAGGGAAGGTGG + Intronic
1152301027 17:79495435-79495457 AGGTGTGGGGAGAGGGAGAGGGG + Intronic
1152473719 17:80504106-80504128 ATGTGTGGATGGAGGGATGGTGG + Intergenic
1152643789 17:81459771-81459793 GGGTGTGTGGGGAGGGAGGGTGG + Intronic
1152972872 18:181892-181914 ATGTATGGTGGGAGGGAGGGAGG + Intronic
1153328168 18:3843120-3843142 GTGTGTGTATATAGGGAAGGTGG + Intronic
1153336941 18:3934466-3934488 ATGTATGGAGAGAGAGAGGGAGG + Intronic
1155032650 18:21997612-21997634 ATGTGTGTAGGGTCGGAAGGAGG - Intergenic
1155095336 18:22549856-22549878 ATGTGGGAAGGGAGGGAGAGAGG + Intergenic
1155311500 18:24528868-24528890 TTGTGTGAAGAGAGGCAGGTAGG + Intergenic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1155620149 18:27768975-27768997 TGGTGAGGAGAGAGGGAGGGAGG - Intergenic
1156352211 18:36311200-36311222 ATGTGTCTGGGCAGGGAGGGCGG + Intronic
1157177584 18:45465557-45465579 ATGGATGAAGGGAGGGAGGGAGG - Intronic
1157340536 18:46773896-46773918 GTGTGTGTAGACAGAGAGAGAGG - Intergenic
1157439412 18:47698723-47698745 ATGAGTGTAGATAGCGAGGTAGG - Intergenic
1157476707 18:48028565-48028587 ATGTGTTTAGAGGTGGAGGGCGG + Exonic
1157666468 18:49491939-49491961 GTTTCTGTAGAGCGGGAGGGAGG - Intronic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1157829408 18:50842966-50842988 ATGTGTATTGAGAGAGAGAGAGG + Intergenic
1157868175 18:51204471-51204493 ATGTGTGGAGATGGGGAAGGTGG - Intronic
1158067775 18:53433767-53433789 GTGTGTGTACAGGGGGAAGGTGG - Intronic
1158315972 18:56211443-56211465 GTGTGTGTAGGGAGGAAGGAAGG - Intergenic
1158395924 18:57078316-57078338 GTGTGTGTGTACAGGGAGGGAGG - Intergenic
1158447573 18:57534452-57534474 TTGTGTGTAGACTGGGTGGGAGG - Intergenic
1158573307 18:58614904-58614926 GTGTGTGTTGGGGGGGAGGGTGG - Intronic
1159445034 18:68531569-68531591 AGGTAGGTAGAGAGGGAGGGAGG + Intergenic
1159584515 18:70271023-70271045 ATGTGGGTTGACATGGAGGGAGG - Intergenic
1159653121 18:71000631-71000653 ATGAGAACAGAGAGGGAGGGAGG + Intergenic
1159851639 18:73532872-73532894 AGGAAGGTAGAGAGGGAGGGAGG + Intergenic
1159951875 18:74489995-74490017 AGGGATGTAGGGAGGGAGGGAGG + Intergenic
1159951877 18:74489999-74490021 ATGTAGGGAGGGAGGGAGGGAGG + Intergenic
1160041259 18:75347746-75347768 AAGAATGAAGAGAGGGAGGGAGG + Intergenic
1160297880 18:77654580-77654602 CTGTGTGATGAGAGGGAGAGCGG - Intergenic
1160429268 18:78800365-78800387 ATGAGTGCAGGGAGGGAGTGAGG - Intergenic
1160429295 18:78800482-78800504 ATGAGTGCAGGGAGGGAGTGAGG - Intergenic
1160429313 18:78800560-78800582 ATGAGTGCAGGGAGGGAGTGAGG - Intergenic
1160429322 18:78800599-78800621 ATGAGTGCAGGGAGGGAGTGAGG - Intergenic
1160522991 18:79519509-79519531 TTGTTTGTAGAGATGGGGGGTGG + Intronic
1160872155 19:1282436-1282458 AGGTGTGAAGGGAAGGAGGGAGG + Intergenic
1160872180 19:1282497-1282519 AGGTGTGAAGGGAAGGAGGGAGG + Intergenic
1160958281 19:1705437-1705459 ATGGATGGAGGGAGGGAGGGAGG + Intergenic
1161088881 19:2349732-2349754 ATGTGTGTGGAGAGAGAGAACGG - Intronic
1161510521 19:4668369-4668391 ATGTCTGGACAGAAGGAGGGAGG - Intronic
1161876004 19:6910298-6910320 ATTTGGGTGGAGCGGGAGGGGGG - Intronic
1162063281 19:8109750-8109772 ATGTCTGTAGGGAGGAAGCGCGG + Exonic
1162183251 19:8885312-8885334 ACCTGCATAGAGAGGGAGGGAGG + Exonic
1162184518 19:8894552-8894574 ACCTGCATAGAGAGGGAGGGAGG + Exonic
1162185735 19:8903527-8903549 ACCTGCGTAGAGAAGGAGGGAGG + Exonic
1162228296 19:9243220-9243242 GTGTGTGTGGAGATGGCGGGAGG - Intergenic
1162826954 19:13258681-13258703 ATTTGCTGAGAGAGGGAGGGAGG + Intronic
1163383657 19:16985742-16985764 ATGGGTGGAGGGAGGGAGGAAGG + Intronic
1163822269 19:19502730-19502752 CTGGGTGCAGAGAGTGAGGGTGG - Intronic
1164025353 19:21346646-21346668 AAGGGGGTAGGGAGGGAGGGAGG + Intergenic
1164157027 19:22603198-22603220 ATCTTTGGAGAGAGGGAGGAGGG - Intergenic
1164411681 19:28011387-28011409 TTGTGTGTAGAGAGGAATGAAGG + Intergenic
1164625283 19:29723770-29723792 ATGCATGTAGAGTAGGAGGGAGG - Intergenic
1164707314 19:30329675-30329697 CTGGGTGCAGAGAGGGAGAGGGG - Intronic
1165257565 19:34588950-34588972 TGGGGTGTACAGAGGGAGGGTGG + Intergenic
1165462521 19:35952542-35952564 ATGTGAGTACAGAGGCAGGAAGG - Intergenic
1165857005 19:38885271-38885293 ATTTTTGTAGAGATGGGGGGTGG + Intronic
1166062417 19:40334951-40334973 AGGGGGGTAGGGAGGGAGGGAGG + Intronic
1166387507 19:42390416-42390438 ATGGGAGTGGAGAGGGAGGGCGG - Intergenic
1166730965 19:45058893-45058915 ATGGGTGGATGGAGGGAGGGAGG - Intronic
1167194219 19:48016064-48016086 ATGTGTGGTGGGAGGGAGAGTGG + Intronic
1167418873 19:49391045-49391067 ATGGGTGCAGAGTGGAAGGGAGG + Intronic
1168316901 19:55488502-55488524 AGCTGGGGAGAGAGGGAGGGAGG - Intronic
1168532032 19:57137813-57137835 AGGAATGGAGAGAGGGAGGGAGG + Intronic
1168705063 19:58465900-58465922 AGGTAGGTATAGAGGGAGGGAGG + Intergenic
925085339 2:1103108-1103130 ATGGGTGTGGAGAGGCTGGGAGG + Intronic
925206338 2:2010203-2010225 TTCTGTGTAGAGAGTGAGGAAGG + Intronic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925636870 2:5949152-5949174 TTGTGTGTAGAGGGGGAGGGAGG + Intergenic
925827783 2:7867023-7867045 ATGTGTGCAAAGAGGAAAGGAGG - Intergenic
926243710 2:11106652-11106674 TTTTTTGTAGAGATGGAGGGCGG - Intergenic
926300114 2:11596374-11596396 ATGTGTATAGTGAGGGGGGACGG + Intronic
926340146 2:11898649-11898671 GTGTGTGTGGTGAGGGAGAGAGG + Intergenic
926406797 2:12561846-12561868 ATAAGTGTAGAGAGGGAAGGTGG + Intergenic
927123461 2:19990377-19990399 AGGTGTGGCGGGAGGGAGGGCGG - Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
927708078 2:25309259-25309281 ATGTCTGAAGAAAGGGAGGGAGG + Intronic
927778017 2:25917030-25917052 ATGTATATATAGAGAGAGGGGGG - Intergenic
928174469 2:29024461-29024483 AAGGGTGCAGGGAGGGAGGGAGG + Intronic
928235504 2:29535978-29536000 ATGTGTGTAAATCGGGAGAGAGG - Intronic
928498600 2:31862940-31862962 AGGTGGGGAGGGAGGGAGGGAGG + Intergenic
928787351 2:34904878-34904900 GTGTGTGTTGGGCGGGAGGGTGG + Intergenic
928825295 2:35413327-35413349 AGGGGAGGAGAGAGGGAGGGAGG + Intergenic
929168899 2:38911490-38911512 ATGTGTGTATATGGGGAGGAGGG + Intronic
929316327 2:40483382-40483404 GTGTGAGTAGAGGGAGAGGGTGG + Intronic
929712882 2:44282365-44282387 ATGTTTGAAATGAGGGAGGGAGG - Intronic
929977311 2:46647383-46647405 AGATGTGCAGAAAGGGAGGGGGG - Intergenic
930366500 2:50446354-50446376 AGGAGTGAAAAGAGGGAGGGAGG - Intronic
930694201 2:54394696-54394718 ATGTGTGGAGGGAGGGAGGGAGG - Intergenic
930979802 2:57510100-57510122 ATATGTGTAAAGAAGGAGGATGG + Intergenic
931391676 2:61849966-61849988 AGGTGGGGAGGGAGGGAGGGAGG + Intronic
931996222 2:67841816-67841838 GTGTCTGTGGAGAGTGAGGGTGG - Intergenic
932099425 2:68883959-68883981 ATATATTTAGAAAGGGAGGGAGG - Intergenic
932780937 2:74557905-74557927 ATTTATGTAGAGATGGCGGGGGG + Exonic
932801896 2:74748250-74748272 GTGTGTGTCTAGAGGGATGGGGG - Intergenic
933040752 2:77462899-77462921 GTGTGTGTAGCGGGGGTGGGGGG + Intronic
933103676 2:78293480-78293502 ATGTAGGTAGGGAGGCAGGGAGG - Intergenic
933783860 2:85822563-85822585 ATGTGGAGAGAGAGGGAGGAAGG - Intergenic
934301970 2:91781768-91781790 ATGAATGGATAGAGGGAGGGAGG - Intergenic
934521517 2:95023030-95023052 GTGTGTGTTCAGGGGGAGGGAGG - Intergenic
934736051 2:96690410-96690432 AGGTGTGGGAAGAGGGAGGGAGG + Intergenic
934844984 2:97656816-97656838 ATGTTGGGAGAGGGGGAGGGAGG - Exonic
934897211 2:98129251-98129273 GTGTGTGTGGAGAGAGAGGGAGG + Intronic
935368048 2:102315279-102315301 CTGTGGGTAGACAGGGAGAGTGG - Intronic
935579471 2:104744258-104744280 ATGTGTGTAAAGCGGAGGGGAGG - Intergenic
935827951 2:106970084-106970106 GTGTGTATAGAGAGAGAGAGAGG - Intergenic
936458969 2:112697333-112697355 AGGGATGGAGAGAGGGAGGGAGG - Intergenic
936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG + Intergenic
937509925 2:122583650-122583672 ATGGATGGAGGGAGGGAGGGAGG + Intergenic
937851583 2:126640831-126640853 ACGTGGGTAGAGAGAGAGAGAGG - Intergenic
938661920 2:133495684-133495706 ATGTCTGTGGAGGGGGAAGGTGG + Intronic
938671151 2:133588270-133588292 AGGTAGGGAGAGAGGGAGGGAGG - Intergenic
938671217 2:133588482-133588504 AGGTAGGAAGAGAGGGAGGGAGG - Intergenic
938699102 2:133860521-133860543 ATGTGTGTGGAGAGCCATGGGGG - Intergenic
939039554 2:137171820-137171842 AAGGATGAAGAGAGGGAGGGAGG - Intronic
939158882 2:138561864-138561886 GAGGGGGTAGAGAGGGAGGGGGG - Intronic
939417761 2:141923478-141923500 GTGTGTGTGTAGAGAGAGGGAGG + Intronic
939417763 2:141923482-141923504 GTGTGTAGAGAGAGGGAGGGAGG + Intronic
939858810 2:147393329-147393351 ATATGTGTAGAGTCAGAGGGAGG + Intergenic
940400809 2:153245605-153245627 GTGTGTGTTGGGAGGGGGGGAGG - Intergenic
940649966 2:156432766-156432788 GTGTGTGAAGAGTGGGAGAGTGG + Intergenic
940788960 2:158011661-158011683 TTGTCTGGAGGGAGGGAGGGAGG + Intronic
941508413 2:166376065-166376087 AGGAGTGGAGAGAGGGAGGGAGG - Intergenic
942134838 2:172914548-172914570 ATGGAGGAAGAGAGGGAGGGAGG + Intronic
942176038 2:173335532-173335554 AAGGGTGGAGAGAGGGAGAGAGG - Intergenic
942849977 2:180472834-180472856 AGGTAAGTAGGGAGGGAGGGAGG - Intergenic
943560563 2:189456628-189456650 ATGACTGTAAAGAGGGAGGAGGG + Intronic
943789586 2:191917344-191917366 TTGTGTGTGGGGAGTGAGGGGGG + Intergenic
943841784 2:192592468-192592490 GTGTGTGGAGAGAGAGAGAGAGG - Intergenic
944192144 2:197014895-197014917 CTGTGTGTGGAGAGGTGGGGTGG - Intronic
944368945 2:198958441-198958463 ATCTGTGTGGTGAGAGAGGGTGG + Intergenic
944651743 2:201837403-201837425 AGGTGGGGAGGGAGGGAGGGAGG + Intronic
944732321 2:202529336-202529358 ATTTGGGTATGGAGGGAGGGTGG - Intronic
944974184 2:205029263-205029285 ATGTGAGTAGAGGGTGATGGTGG - Intronic
944977828 2:205077156-205077178 AGGTGAGTAGAGAGGGAGGGAGG + Intronic
945541897 2:211098269-211098291 GTGGGTGGAGGGAGGGAGGGAGG - Intergenic
945655345 2:212616520-212616542 AGGAGGGAAGAGAGGGAGGGAGG - Intergenic
945674830 2:212843567-212843589 ATTTGTGTTGGGAGGAAGGGTGG - Intergenic
945687732 2:212992737-212992759 ATGTCGGTAGTGAGGAAGGGGGG - Intergenic
945721491 2:213422664-213422686 TTGTGTGTACAGAGGGTGGGAGG - Intronic
945768300 2:214007964-214007986 AGGGGTGAAGAGAAGGAGGGAGG - Intronic
946547953 2:220766358-220766380 TTATCTGTAGAGAGAGAGGGTGG - Intergenic
946962484 2:224999498-224999520 AAGAGGGGAGAGAGGGAGGGAGG - Intronic
947017541 2:225638184-225638206 GTGTGTGTGGTGTGGGAGGGGGG + Intronic
947159130 2:227194070-227194092 AAGTAAGGAGAGAGGGAGGGAGG + Intronic
948540683 2:238689826-238689848 AGGAGTGTAGGAAGGGAGGGAGG + Intergenic
948621399 2:239237094-239237116 AGGTGTGCAGACAGGGAAGGAGG + Intronic
1168787471 20:552347-552369 ATGAGTGTAGACAGAGAAGGAGG + Intergenic
1168826371 20:817112-817134 GTGTGTGTAGAGAGGGGCAGGGG + Intergenic
1168922993 20:1556681-1556703 ATGTGAGGATACAGGGAGGGTGG + Intronic
1169027440 20:2382775-2382797 ATGGATGGAGTGAGGGAGGGGGG - Intronic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169586286 20:7089778-7089800 AAATGTAGAGAGAGGGAGGGAGG + Intergenic
1169637901 20:7714980-7715002 ATGGGTGGAGGGAGGCAGGGAGG + Intergenic
1169833511 20:9852287-9852309 ATGAGTATAGAGAGATAGGGAGG + Intergenic
1169849490 20:10034422-10034444 ATGTGTGGAGGGAGAGAGAGGGG + Intronic
1170007047 20:11680768-11680790 TTGTGGGCAGATAGGGAGGGAGG + Intergenic
1170100659 20:12695975-12695997 GTGTGTGGCAAGAGGGAGGGAGG - Intergenic
1171288807 20:23967747-23967769 ATGAGAGGAGAGAGGAAGGGAGG + Intergenic
1171399178 20:24860730-24860752 ATGGGTGGATAGATGGAGGGAGG + Intergenic
1172036331 20:32013417-32013439 GTGTGTGTGGAGTGGGGGGGTGG + Intronic
1172055311 20:32150601-32150623 AACTGTGGAGGGAGGGAGGGAGG - Exonic
1172299067 20:33835838-33835860 ATGTGTGTGGCGAGAGAGAGAGG + Intronic
1172318476 20:33976034-33976056 ATATATGTAGAGAGAGAGAGAGG + Intergenic
1172448605 20:35006210-35006232 TTGTGGGTAGGGAGTGAGGGTGG - Intronic
1172592751 20:36128957-36128979 GTGGGTGGAGAGAGGGAGGAAGG + Intronic
1172625593 20:36344852-36344874 ATGTGCCTAGGGAAGGAGGGGGG - Intronic
1172798156 20:37557625-37557647 GTGTGTGTAGGGTGGTAGGGTGG + Intergenic
1173134089 20:40423942-40423964 ATGTGTGTGCAGAGGGGAGGAGG - Intergenic
1173516641 20:43669146-43669168 TTTTGTGTAGAGATGGAAGGGGG + Intronic
1173583145 20:44161411-44161433 ATGTGTGTGGAGAGGCAGCAGGG + Intronic
1173623681 20:44455812-44455834 ATGAGTGAAGAGAAGAAGGGAGG + Intronic
1173830728 20:46085481-46085503 ATGTGTGTATGGAGGGGGTGGGG + Intronic
1173857826 20:46262211-46262233 GTGTGTGTTGAGGGGGTGGGGGG + Intronic
1173942514 20:46923702-46923724 GTGTGTGTGGAGAGAGAGAGAGG + Intronic
1174617542 20:51847445-51847467 AATTGTGTAGAAAGGGAGCGGGG + Intergenic
1174747052 20:53073361-53073383 ATGGATGGAGGGAGGGAGGGAGG - Intronic
1175074959 20:56364419-56364441 ATAAGTGAAGAGAGGGAGGCAGG - Intronic
1175222865 20:57427237-57427259 ATGTGTTTAGAGGGAGAGGTTGG - Intergenic
1175316763 20:58054136-58054158 ACCAGAGTAGAGAGGGAGGGAGG + Intergenic
1175515606 20:59568102-59568124 GTGTGTGTAGAGTGGGGGTGGGG + Intergenic
1175676410 20:60949895-60949917 ATGGAGGTAGGGAGGGAGGGAGG + Intergenic
1175765766 20:61591527-61591549 AGGTGTGTAGATGGGAAGGGAGG + Intronic
1175781053 20:61682310-61682332 ATGGAAGGAGAGAGGGAGGGAGG + Intronic
1175817959 20:61893385-61893407 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818037 20:61893706-61893728 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818051 20:61893757-61893779 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818064 20:61893804-61893826 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175972274 20:62692662-62692684 GTGTGTGTAGAGGAAGAGGGAGG + Intergenic
1175984041 20:62755379-62755401 ATGGATGGAGGGAGGGAGGGTGG - Intronic
1175984161 20:62755733-62755755 ATGGCTGGAGGGAGGGAGGGAGG - Intronic
1175984203 20:62755849-62755871 ATGGGTGGAGGGAGGGAGGATGG - Intronic
1176292195 21:5052346-5052368 ATGGATGGAGGGAGGGAGGGAGG - Intergenic
1176742547 21:10617246-10617268 ATGAGAGAAGGGAGGGAGGGAGG + Intergenic
1176878001 21:14153503-14153525 ATGTATTTATAGTGGGAGGGTGG - Intronic
1177047620 21:16190038-16190060 ACGGGGGAAGAGAGGGAGGGAGG - Intergenic
1177209981 21:18059173-18059195 GTGTGTGTACAGAGAGAGAGAGG - Intronic
1177560609 21:22746474-22746496 ATGTAGGTAGAGAGGGTGTGAGG + Intergenic
1177674372 21:24277308-24277330 GAGTGGGGAGAGAGGGAGGGAGG - Intergenic
1177731233 21:25028917-25028939 GTGTGTGGAGAGGGAGAGGGAGG - Intergenic
1178538598 21:33430625-33430647 TTTTCTGTAGAGACGGAGGGAGG + Intronic
1178562766 21:33654566-33654588 TTTTGTGTAGAGAAGGAGGTAGG - Intronic
1178890205 21:36514655-36514677 GTGTGTGTAGAGAGACAGGAGGG + Intronic
1179007662 21:37529462-37529484 ATGGATGGAGGGAGGGAGGGAGG + Intergenic
1179413800 21:41181919-41181941 GTGTATGTGGACAGGGAGGGTGG - Intronic
1179479999 21:41670806-41670828 AGGTGTGGACAGAGGAAGGGAGG + Intergenic
1179865064 21:44211308-44211330 ATGGATGGAGGGAGGGAGGGAGG + Intergenic
1180043097 21:45290346-45290368 ATGTGGTTAGAGTGGGAGGGGGG + Intergenic
1180814459 22:18780955-18780977 ATGAATGGATAGAGGGAGGGAGG + Intergenic
1181063201 22:20291832-20291854 GTGTGTGTGAAGAGGGAGGCAGG - Intergenic
1181200647 22:21215291-21215313 ATGAATGGATAGAGGGAGGGAGG + Intronic
1181482146 22:23206958-23206980 ATGGATGGAGGGAGGGAGGGAGG - Intronic
1181662855 22:24365971-24365993 AAGGTTGTAGACAGGGAGGGTGG + Intronic
1181750147 22:24983595-24983617 ATGTGTGTATGGTGGGGGGGCGG + Intronic
1181897147 22:26120396-26120418 AGGGATGAAGAGAGGGAGGGAGG + Intergenic
1181967456 22:26666953-26666975 ATGTGGGGAGGGAGGGAGGGAGG + Intergenic
1182123934 22:27802918-27802940 GTGTGTGTAGGGAAGGAGGGGGG + Intergenic
1182353629 22:29712415-29712437 ATGAGAGTAGAGAGGGGAGGAGG + Intergenic
1182641146 22:31768773-31768795 AGGGGTAGAGAGAGGGAGGGAGG - Intronic
1182727084 22:32456447-32456469 ATGAGGGAAGGGAGGGAGGGAGG - Intronic
1182731577 22:32499976-32499998 ATGTGTGTAGTGGGCGTGGGAGG + Intergenic
1182790957 22:32952306-32952328 GTGTGTGTGGACAGGCAGGGTGG + Intronic
1182850129 22:33466679-33466701 GTGTGTGTAGAGAGAGAGAGGGG - Intronic
1183001617 22:34864339-34864361 AGGTGTGTATGGAGGGTGGGCGG - Intergenic
1183162908 22:36126782-36126804 ATGGAGGGAGAGAGGGAGGGAGG - Intergenic
1183209727 22:36443400-36443422 AGGAGTGAAGGGAGGGAGGGAGG - Intergenic
1183257628 22:36772852-36772874 ATGTGTGTGGTGGGGGTGGGTGG + Intronic
1183494441 22:38134587-38134609 ATATATATAGAGAGAGAGGGGGG - Intronic
1183718295 22:39547123-39547145 GTGTGTGTAGAGGGGAGGGGAGG + Intergenic
1184015547 22:41783258-41783280 ATGTGTGTCGGGGGTGAGGGGGG - Intronic
1184293109 22:43508711-43508733 ATGGATAGAGAGAGGGAGGGAGG - Intergenic
1184476441 22:44724613-44724635 AGGTATGTAGGGAGGGAAGGAGG + Intronic
1184598425 22:45528061-45528083 ATGTGTATATAGAGCGAGAGTGG + Intronic
1184944590 22:47794114-47794136 AGGTGTGAAGGGAGGGAGGAAGG - Intergenic
1184967961 22:47995377-47995399 AGGGTTGGAGAGAGGGAGGGAGG + Intergenic
1185001632 22:48250029-48250051 ATGTGTTTAGAGGGGGATGTGGG - Intergenic
1203226270 22_KI270731v1_random:80144-80166 ATGAATGGATAGAGGGAGGGAGG - Intergenic
1203264558 22_KI270734v1_random:6642-6664 ATGAATGGATAGAGGGAGGGAGG + Intergenic
1203322947 22_KI270737v1_random:86267-86289 ATGAGGGAAGGGAGGGAGGGAGG - Intergenic
949327866 3:2887380-2887402 CTGGGTGTGGAGAGTGAGGGTGG + Intronic
950094345 3:10319983-10320005 GAGTGGGGAGAGAGGGAGGGTGG + Intronic
950151981 3:10694842-10694864 CTGTCAGCAGAGAGGGAGGGGGG - Intronic
950167854 3:10815186-10815208 TTGTGGCTAGAGAGGAAGGGAGG - Intergenic
952184958 3:30958549-30958571 CTGTGTGTGGAGATGAAGGGAGG - Intergenic
952255110 3:31688245-31688267 ATTTGTGCAGGGAGGGATGGGGG - Intronic
953902420 3:46850709-46850731 ATGGATGGAGGGAGGGAGGGAGG + Intergenic
953903717 3:46857767-46857789 AGGTGGGTAGGAAGGGAGGGAGG + Intergenic
953912531 3:46900176-46900198 ATGTATGTCGAGGGGCAGGGAGG - Intronic
954059890 3:48058270-48058292 TTGTACGGAGAGAGGGAGGGAGG + Intronic
954622269 3:52002977-52002999 AGCTGGGAAGAGAGGGAGGGAGG - Intergenic
954743739 3:52774886-52774908 ATGTTTGCACAGGGGGAGGGTGG - Intergenic
954906469 3:54067514-54067536 AAGTGAGAAGAGAGGGAGGAAGG - Intergenic
955509154 3:59662100-59662122 ATGTGTGATGAGCAGGAGGGAGG + Intergenic
955591948 3:60546522-60546544 AAGTGGGGAGAGAGGGATGGTGG - Intronic
955671861 3:61410763-61410785 ATGTTTTTAGAGACGGGGGGGGG - Intergenic
956040504 3:65140234-65140256 TTGTTTGTGGAGAGGGAGGAAGG + Intergenic
956540791 3:70336850-70336872 GTGTGTGTGGAGAGAGAGAGAGG + Intergenic
957055576 3:75440204-75440226 ATTTTTGTAGAGATGGAAGGTGG + Intergenic
958974946 3:100657236-100657258 ATGTGTGTAGGGTGGAAGGTGGG - Intronic
959684284 3:109128014-109128036 TTTTGTGTAGAGAGGTTGGGAGG + Intergenic
959848757 3:111063912-111063934 ATTTTTGTAGAGATGGGGGGGGG - Intergenic
960155430 3:114293202-114293224 ATGAATGAAGGGAGGGAGGGAGG + Intronic
960318845 3:116209591-116209613 ATGTGTGAAGAGTAAGAGGGGGG + Intronic
961514549 3:127424576-127424598 ATGTGTGAACAGGGAGAGGGAGG - Intergenic
961514554 3:127424603-127424625 GTGTGTGAACAGAGAGAGGGAGG - Intergenic
961569042 3:127785189-127785211 AGGTGTGTGGGGAAGGAGGGGGG - Intronic
961930828 3:130531001-130531023 GTGTGTGTAGAGGAGGGGGGTGG - Intergenic
962083675 3:132167587-132167609 ATGTGTTCAGAGAGGGGAGGAGG + Intronic
962229418 3:133648467-133648489 ATGAGTGGAGAGAGGGAGCAGGG + Intronic
963127784 3:141831224-141831246 TTGTGTGTAGAGATGGAGAAAGG + Intergenic
963156290 3:142100675-142100697 AGGTGTGAAGAAAGGGAAGGAGG - Intronic
963237500 3:142970275-142970297 ATTGGTGCGGAGAGGGAGGGAGG - Intronic
963490341 3:145992355-145992377 GTGTGTGTAGAAAGAGAGAGAGG + Intergenic
963826900 3:149965697-149965719 ATGTGCGAAGGGAGGGGGGGCGG + Exonic
964557353 3:157954161-157954183 GTGTGTGTGGAGGGGGGGGGCGG - Intergenic
964592048 3:158376063-158376085 AGGGGGGTCGAGAGGGAGGGAGG - Intronic
964683800 3:159371483-159371505 AGGTCTGTATAAAGGGAGGGAGG + Intronic
965355403 3:167667221-167667243 AGTTTTGTAGGGAGGGAGGGAGG + Intergenic
965368966 3:167837000-167837022 GTGTTTGCAGAGTGGGAGGGTGG + Intergenic
965473160 3:169120571-169120593 ATGTGTGTGGAGAGAGCGAGGGG - Intronic
965542832 3:169887644-169887666 ATGTGTGTGGAGAGGGAGTGAGG - Intergenic
965977965 3:174648875-174648897 ATGTGTTGAGAGAGAGAGGTTGG + Intronic
966574877 3:181489084-181489106 ATGTGTGGAGAGGGGATGGGAGG + Intergenic
967734891 3:192941751-192941773 AAGAGGGAAGAGAGGGAGGGAGG - Intergenic
967899980 3:194440054-194440076 ATGTGGGTAGGGAGGGAGGGAGG + Intronic
968527854 4:1073251-1073273 ATGTGTGCTGAGGGTGAGGGAGG + Intronic
970872182 4:20828773-20828795 ATGTGTGTAGGTATGGAGGTAGG - Intronic
971047789 4:22825131-22825153 GTGTGTATAGAGAGAGAGAGAGG - Intergenic
972452310 4:39214365-39214387 CTGTGTGCAGAGATGGGGGGCGG - Intronic
972910335 4:43808434-43808456 ATGAATGTAGAGAGGGAGGGAGG + Intergenic
973180213 4:47257548-47257570 GTGGGTGTAGGGAGGGAGGGTGG + Intronic
973663263 4:53130581-53130603 GTGTGTGTGTAGAGGGAGAGGGG - Intronic
973797243 4:54440072-54440094 ATGTGTGTGGGGGGGGGGGGGGG + Intergenic
973865471 4:55108700-55108722 AAGGGAGTGGAGAGGGAGGGAGG - Intronic
974020434 4:56687951-56687973 AGGTGGATAGAGAGGGAGGGAGG + Intergenic
974424886 4:61729046-61729068 ATATTTGTAGAGAGGGAGGGAGG + Intronic
974835097 4:67238806-67238828 AAGTAGGGAGAGAGGGAGGGAGG - Intergenic
975229391 4:71913647-71913669 TTGTGTGTAGTGAGTGAGGAGGG + Intergenic
975257750 4:72257590-72257612 ATTTGTGTGAAGAAGGAGGGTGG - Intergenic
976137701 4:81957037-81957059 AGGTGTGTGGGGAGAGAGGGAGG - Intronic
976178666 4:82379032-82379054 ATGTGGGGGGTGAGGGAGGGGGG - Intergenic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976550538 4:86389918-86389940 ATGGGGGCAGAGAGAGAGGGAGG - Intronic
977065225 4:92305283-92305305 ATGTGAGAAGAGAGGGTGGCTGG - Intronic
978195994 4:105972790-105972812 ATGTGTAAGGAAAGGGAGGGGGG + Intronic
978327413 4:107575153-107575175 AGGTGTGTGGAGTGGGAAGGTGG - Intergenic
979092380 4:116501647-116501669 AGGTAGGTAGTGAGGGAGGGAGG - Intergenic
979804829 4:124958409-124958431 GTGTGTGTATAGAGAGAGAGAGG + Intergenic
979993943 4:127408624-127408646 CTGTCTGTAGTGAGGTAGGGAGG - Intergenic
980038685 4:127914279-127914301 ATATGGGGAGGGAGGGAGGGAGG - Intergenic
980098080 4:128513691-128513713 ATGTGTGAGTACAGGGAGGGAGG - Intergenic
980693309 4:136323703-136323725 ATGTGTGTGTGGAGAGAGGGAGG + Intergenic
980893626 4:138840210-138840232 GTGTGTGGAGAGAGAGAGAGAGG - Intergenic
982304296 4:153913754-153913776 ATGGCTGGAGAAAGGGAGGGAGG - Intergenic
982380434 4:154743129-154743151 GTGTGTGTAGGGCGGGGGGGGGG - Intronic
982637631 4:157916857-157916879 ATGTGTGTGAGGAGGGAGAGTGG + Intergenic
983066528 4:163216305-163216327 AAGGGAGGAGAGAGGGAGGGAGG + Intergenic
983280057 4:165669123-165669145 ATGAGTGTAGACAGGCAGGGAGG - Intergenic
983293346 4:165834335-165834357 ATGTTGGCAGAGAGAGAGGGAGG + Intergenic
983426721 4:167593532-167593554 GTGTGTGTTGAGAAAGAGGGAGG - Intergenic
983506853 4:168562692-168562714 ATGTTTGAAGAGAGGGAAGGAGG + Intronic
983561303 4:169104292-169104314 ATGCCTGGAGGGAGGGAGGGAGG + Intronic
983922795 4:173365615-173365637 ATGTGAGGAGAAAGAGAGGGAGG - Intergenic
984033810 4:174639713-174639735 ATGTTTGTAAAGAGGAATGGGGG + Exonic
984510247 4:180670161-180670183 ATGTGTGTAGAGAGGAGGAAAGG + Intergenic
984922421 4:184777471-184777493 ATGTACAAAGAGAGGGAGGGAGG + Intronic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
987101519 5:14595233-14595255 CTGTGTGTAGAGAGAAAGTGTGG + Intronic
987199606 5:15562693-15562715 ATGAATGGAGAGAGGAAGGGAGG - Intronic
987861329 5:23491901-23491923 ATGTGTGTTGACTGGGTGGGTGG + Intergenic
988636882 5:32994539-32994561 GTGTGTGTAGAGAGGGAGGTAGG - Intergenic
989512979 5:42309881-42309903 ATGTGGGTAGAGAAGGAGAAAGG + Intergenic
989697717 5:44223157-44223179 ATGAGGGGAGGGAGGGAGGGAGG + Intergenic
990182309 5:53174594-53174616 GTGTGGGAAGGGAGGGAGGGAGG - Intergenic
990442644 5:55861932-55861954 ATATGAGTATAGAGGGAAGGAGG + Intronic
990558781 5:56963248-56963270 ATGTGTCGAGAGAGGGAGGGAGG + Intronic
991385026 5:66077747-66077769 GTGTGTGTGTAGAGGGAGGGAGG - Intronic
991653622 5:68881718-68881740 AGGCATGGAGAGAGGGAGGGAGG - Intergenic
992104508 5:73438251-73438273 ATCTATGCAGATAGGGAGGGAGG + Intergenic
992132598 5:73708344-73708366 AGGTGGGGAGAAAGGGAGGGAGG - Intronic
992496326 5:77297713-77297735 ATGTGGCTAGAGAGGGAGGAAGG - Intronic
992519997 5:77540716-77540738 AAGAATGTAGGGAGGGAGGGAGG + Intronic
992519999 5:77540720-77540742 ATGTAGGGAGGGAGGGAGGGAGG + Intronic
992624852 5:78627639-78627661 ATGTTTGCAGAGAGGGAGTGAGG - Intronic
992670857 5:79059907-79059929 ATGTGTGATGAAAGGGAGAGGGG - Intronic
993125032 5:83823622-83823644 AAATAGGTAGAGAGGGAGGGTGG - Intergenic
993125156 5:83825482-83825504 TAGTGTGTAGAGAGAGAGAGAGG + Intergenic
993164700 5:84337359-84337381 AAGCGTGAAGAGAGGGAGTGGGG + Intronic
993526657 5:88973654-88973676 ATGGAGGGAGAGAGGGAGGGAGG + Intergenic
994206040 5:97036585-97036607 AGGAGAGCAGAGAGGGAGGGAGG - Exonic
994611065 5:102040347-102040369 TTGTGTGTATAGAGGGGAGGGGG - Intergenic
995416699 5:111921151-111921173 ATGTGAGAAGAGAGAGAGAGAGG - Intronic
995561975 5:113391847-113391869 ATGGGTGTGGAGAGGGAGGTAGG + Intronic
995819468 5:116212516-116212538 GTGTGTGTAGAATGTGAGGGGGG + Intronic
996090918 5:119351028-119351050 GTGTGTGTAGAGAGAGAGAGGGG + Intronic
996400136 5:123053511-123053533 GTGTGTGTAGAGAAAGAGAGAGG + Intergenic
996475902 5:123920293-123920315 GTGTGTGGAGAGAGAGAGAGGGG - Intergenic
996475904 5:123920295-123920317 GTGTGTGTGGAGAGAGAGAGAGG - Intergenic
996879597 5:128280676-128280698 AGGTGTGGGGAGAGGGATGGTGG + Intronic
997151169 5:131496971-131496993 ATGTGTGTAGGGTGGGGGTGGGG + Intronic
997268170 5:132510944-132510966 ATGTGTGTAGAGAGAGAGAGAGG - Intergenic
997876762 5:137556550-137556572 ATATGTGTAATGAGGAAGGGAGG + Intronic
998704307 5:144741068-144741090 ATATATGGAGGGAGGGAGGGAGG - Intergenic
998870993 5:146551485-146551507 AACTGGATAGAGAGGGAGGGAGG + Intergenic
999188216 5:149728575-149728597 ATGAGTGTAGGGTGGGAGGAGGG + Intergenic
999241133 5:150128058-150128080 ATGTGTGATGAGCGGGAGGAGGG - Intronic
999531650 5:152469605-152469627 AAGTGTGGAGAGAGGGTGGAAGG + Intergenic
1000546112 5:162604822-162604844 ATGTATGTAGAGCTGGAGGCTGG + Intergenic
1000613702 5:163404629-163404651 GTGTGTGTAAGGAGGGAGGGGGG - Intergenic
1000633972 5:163622579-163622601 ATGTATGTAGATAGTGAAGGAGG + Intergenic
1000845405 5:166273875-166273897 ATGTGTGGTTAGAGGGTGGGGGG + Intergenic
1000935359 5:167299472-167299494 ATGTGTGTAGGGAAGGGAGGGGG + Intronic
1000983786 5:167845226-167845248 GTGTGTGTGGCGCGGGAGGGGGG - Intronic
1001032401 5:168272368-168272390 ATGTGTGGAGTGAGGGAGTGGGG - Intergenic
1001266908 5:170280330-170280352 ATGTGTGCAGGGAGGAGGGGTGG - Intronic
1001686509 5:173598008-173598030 ATGGATGGAGGGAGGGAGGGAGG - Intergenic
1001791118 5:174458652-174458674 ATGTGTGTGGGGAGGTAGGGAGG - Intergenic
1001820436 5:174705952-174705974 ATGTGTGGAGAGAGGCAGGGAGG - Intergenic
1001906250 5:175476020-175476042 ATGTGTGTGGTGGGGAAGGGAGG + Intergenic
1002133406 5:177094701-177094723 AGCTGTGTAGAGAGGAGGGGAGG - Intronic
1002190738 5:177476173-177476195 CTGTGAGGAGGGAGGGAGGGAGG - Intergenic
1002453538 5:179332738-179332760 AGGAGTGCAGAGAGGAAGGGAGG + Intronic
1002586112 5:180249447-180249469 AGGCGTGGAGAGCGGGAGGGGGG - Intronic
1002663976 5:180809797-180809819 ATGTGTGTTGAGAGAGAGAATGG - Exonic
1002966033 6:1967128-1967150 ATGTTTTTAGCGAGGGAGGCAGG - Intronic
1002987582 6:2205769-2205791 GTGTGTGTGGGGGGGGAGGGGGG + Intronic
1003063878 6:2885603-2885625 AAGAAGGTAGAGAGGGAGGGAGG - Intergenic
1003153201 6:3570132-3570154 ATGTGGGTAGAGCAGGAGAGAGG - Intergenic
1003163055 6:3652305-3652327 TTGTGTGTCGAGAGGGGGTGAGG - Intergenic
1003199709 6:3947816-3947838 AGGGATGTAGGGAGGGAGGGAGG + Intergenic
1003687489 6:8318745-8318767 ATGTGTGTATGGAGGGAGAGGGG - Intergenic
1004015449 6:11727972-11727994 AGGTAGGTAGGGAGGGAGGGAGG + Intronic
1004238150 6:13893896-13893918 ATGTGAGGACAGAGTGAGGGGGG + Intergenic
1004287332 6:14333813-14333835 ATGAGTTTTGGGAGGGAGGGTGG - Intergenic
1004331804 6:14728697-14728719 ATGTGGGCAGAGAAGGAGGAGGG + Intergenic
1004672320 6:17809253-17809275 TTGTGTGTGCTGAGGGAGGGTGG + Intronic
1004683737 6:17921672-17921694 AGGTGGGGAGAGAGGAAGGGAGG + Intronic
1004845176 6:19633892-19633914 GTGTGTGTGGAAAGGGAGGTGGG + Intergenic
1005164796 6:22907375-22907397 GTGTGTGTAGGGAGTGAGGATGG - Intergenic
1005744680 6:28825386-28825408 ATGAGGGAAGAGAGGTAGGGAGG + Intergenic
1005800843 6:29422079-29422101 TGGGGTGTAGAGTGGGAGGGGGG + Intronic
1006004094 6:30988776-30988798 CTGTGTGTGGGGGGGGAGGGGGG + Exonic
1006149564 6:31979359-31979381 AGGTTGGTAGAGAGTGAGGGTGG + Intronic
1006277073 6:33013651-33013673 ATGTGTGTAAAGAGAAAGGAGGG + Intergenic
1006361419 6:33589389-33589411 ATCTGTGCAGAGAGGGCAGGAGG + Intergenic
1006529009 6:34633870-34633892 ATGGAGGGAGAGAGGGAGGGAGG + Intronic
1006598276 6:35209275-35209297 ATGTGGGCAGAGAGGAGGGGTGG + Intergenic
1007183498 6:39947937-39947959 ATGGGTGTAGGGAGGGAGGGAGG + Intergenic
1007641381 6:43342622-43342644 AAGTTTGAAGAGAGTGAGGGTGG + Intronic
1007797710 6:44363726-44363748 AAGGATGGAGAGAGGGAGGGAGG - Intronic
1008522157 6:52372468-52372490 ATGTTTCTAGAGAGGCAGGCTGG + Intronic
1008565246 6:52761776-52761798 ATATCTGCAGAGAGGGAGGGGGG + Intronic
1008709618 6:54208847-54208869 AACTGTGTAGGGAGGGAGGGAGG - Intronic
1008983551 6:57514856-57514878 ATGTGTGTGGGTGGGGAGGGGGG - Intronic
1009803720 6:68574929-68574951 ATGGTAGTAGGGAGGGAGGGAGG + Intergenic
1010331659 6:74630130-74630152 AGGTGTTTGGGGAGGGAGGGAGG - Intergenic
1010462970 6:76134087-76134109 AGGTCTGGAGGGAGGGAGGGAGG + Intergenic
1010684479 6:78837164-78837186 ATATGTTTAGAAAGGGAGGGAGG - Intergenic
1011074242 6:83421008-83421030 CTGTATGCAGACAGGGAGGGGGG + Intronic
1011493375 6:87915348-87915370 ATGTGTGTGTGGAGGGTGGGAGG + Intergenic
1011814388 6:91171633-91171655 AGGAGTGGAGAGAGGAAGGGAGG + Intergenic
1011855718 6:91688384-91688406 AGGTATGAAGAGAGGGAAGGAGG - Intergenic
1011892813 6:92188306-92188328 ATACATGTAGAGAGAGAGGGAGG + Intergenic
1012276849 6:97284468-97284490 GTGTGTGCAGAGAGAGAGGAGGG - Intergenic
1013256810 6:108395775-108395797 AGATAGGTAGAGAGGGAGGGAGG + Intronic
1013703639 6:112805710-112805732 ATGTGGGGAGAGATGGAAGGAGG - Intergenic
1013970894 6:116017165-116017187 GTGTGTGTTGGGAGGTAGGGAGG - Intronic
1014334495 6:120115982-120116004 ATGTGTGTTGAGAGCCAGGGTGG - Intergenic
1014827838 6:126066469-126066491 ATGTATGTCGAGAGGGAAGATGG + Intergenic
1015877224 6:137834877-137834899 ATGCCGGAAGAGAGGGAGGGAGG + Intergenic
1015891759 6:137976785-137976807 GTGTGTGTAGGGAGGCAGGATGG - Intergenic
1015903337 6:138090273-138090295 ATGGGTGCAGAGAGGCTGGGTGG - Exonic
1015933693 6:138387196-138387218 ATTTTTGTAGAGATGGTGGGGGG - Intergenic
1016286843 6:142483232-142483254 ATGTTTATAGAGAGGGTGTGAGG + Intergenic
1016525541 6:144997967-144997989 AAGTGAGGAGAGAGTGAGGGAGG + Intergenic
1016818157 6:148322954-148322976 AGGGAAGTAGAGAGGGAGGGAGG - Intronic
1017324459 6:153130455-153130477 ATGTATGTATAGGGGGTGGGGGG - Intronic
1018005860 6:159620924-159620946 ATGGAGGGAGAGAGGGAGGGAGG + Intergenic
1018017408 6:159724897-159724919 AGGGGGGAAGAGAGGGAGGGAGG + Intronic
1018070972 6:160164126-160164148 CCGTCTGTAGAGAGGAAGGGTGG - Intergenic
1018570433 6:165204137-165204159 ATGTGTTGAGGGAGGGAGGGAGG - Intergenic
1018638299 6:165884077-165884099 GGGTGTGCAGAGAAGGAGGGAGG + Intronic
1019095375 6:169575285-169575307 ATGGATGGAGAGAGGGAGGGAGG - Intronic
1019199598 6:170303650-170303672 ATGTGTCTAGGAAGTGAGGGTGG - Intronic
1019281388 7:202180-202202 ATGTGCATAGAGAGGACGGGTGG + Intronic
1019467086 7:1195912-1195934 GTGTGTGTGGAGAGAGAGAGAGG - Intergenic
1019668068 7:2262492-2262514 TTGTGTGTGGAGCGGGAGGTGGG + Intronic
1019703615 7:2487280-2487302 ATGGGTGGGGGGAGGGAGGGAGG + Intergenic
1019935008 7:4249091-4249113 GTGAGTGTGGGGAGGGAGGGAGG + Intronic
1020112554 7:5455737-5455759 GTGTGTGTAGTGGGGGTGGGGGG - Intronic
1020253080 7:6484584-6484606 ATTTTTGTAGAGACGGGGGGTGG - Intergenic
1020378555 7:7515630-7515652 ATGTGTGTTGTAAGGGATGGAGG - Intronic
1021262863 7:18480496-18480518 AAGTTTGTAGGGAGGGAGAGTGG + Intronic
1021697362 7:23287779-23287801 TTGAGGGTGGAGAGGGAGGGTGG - Intergenic
1021794329 7:24238441-24238463 ATATGTATAGAGAGAGAGAGGGG + Intergenic
1022945381 7:35278861-35278883 ATGTGTGTGGAGATGGATGCAGG + Intergenic
1023346539 7:39277395-39277417 AAGAAAGTAGAGAGGGAGGGGGG - Intronic
1023561144 7:41474483-41474505 ATGTGTGGAGACAGGGGGTGGGG - Intergenic
1023710401 7:42986492-42986514 ATGTGTGTGGAGAGGGGGTGGGG - Intergenic
1024387465 7:48769290-48769312 ATGTGGGTAAAGAGGAAAGGAGG + Intergenic
1025873106 7:65453455-65453477 ATGTGTTTTGAGGGGGAGGGAGG - Intergenic
1026143276 7:67724117-67724139 ATGTGGGCAGAGACGAAGGGAGG - Intergenic
1026213190 7:68324871-68324893 ATCTGTATATGGAGGGAGGGAGG - Intergenic
1026438907 7:70425537-70425559 ATGAGTGGAAGGAGGGAGGGAGG + Intronic
1026471087 7:70694515-70694537 ATGTGCGGAGGGAGGGAGGAGGG - Intronic
1026571933 7:71538863-71538885 ATGGTGGGAGAGAGGGAGGGAGG + Intronic
1026931039 7:74223123-74223145 GTGGCTGGAGAGAGGGAGGGAGG - Intronic
1026953218 7:74361115-74361137 ATGAATGGAGGGAGGGAGGGAGG - Intronic
1027159227 7:75790246-75790268 AGGTATGGAGGGAGGGAGGGAGG - Intergenic
1027461146 7:78455152-78455174 ATATGTGTGTGGAGGGAGGGTGG + Intronic
1027587873 7:80080324-80080346 ATGTGTGCAGAGAGAGTGCGTGG - Intergenic
1027602652 7:80258388-80258410 GTGTGTGTAGAGAAAGAGAGAGG - Intergenic
1027625404 7:80538550-80538572 GTGTGACTAGAGAGGGAGTGTGG - Intronic
1028163081 7:87507978-87508000 ATTAGTGTAGGGAGGGAAGGGGG + Intronic
1028763654 7:94525129-94525151 GTATGTGTAGAGAGGGAGAAAGG + Intronic
1028923544 7:96332514-96332536 GTGTGTGTAGAGAGAGAGAGAGG + Intergenic
1029495596 7:100894377-100894399 ATGAGGGGAGAGAGGGAGGGAGG + Intronic
1029580418 7:101433474-101433496 AGGTGTTTCCAGAGGGAGGGTGG + Intronic
1029666185 7:101996650-101996672 ATGGATGGAGGGAGGGAGGGAGG - Intronic
1029923098 7:104287227-104287249 TTGTATCTAGTGAGGGAGGGAGG - Intergenic
1030688591 7:112510415-112510437 ATGAGAGTAGTGAGGGAGGAAGG + Intergenic
1030974718 7:116107277-116107299 ATGGCTGTAGGGAGAGAGGGAGG - Intronic
1031780767 7:125961017-125961039 ATGTGTGTGGAGAAAGAGAGGGG + Intergenic
1031982144 7:128135144-128135166 GTGTGTGTGGAGAGAGAGAGAGG - Intergenic
1032520939 7:132544534-132544556 AAGTGTGCAGAGGGTGAGGGGGG + Intronic
1032539922 7:132694421-132694443 ATGGGTGGAGAAAGGGAGGCTGG - Intronic
1032582554 7:133116863-133116885 GTGTGTGTGGGGAGGGGGGGCGG - Intergenic
1032984066 7:137317431-137317453 ATGTGGGTAAAGAGTGTGGGAGG + Intronic
1033389820 7:140916137-140916159 ATGTTTCTAGAGAGGAAGTGTGG - Intronic
1033485167 7:141781832-141781854 AGGTAAGTAGGGAGGGAGGGAGG - Intronic
1033664557 7:143428191-143428213 ATGTGTGTAGCCAGGCACGGTGG - Intergenic
1033874292 7:145795242-145795264 ATGGAGGGAGAGAGGGAGGGAGG + Intergenic
1033927266 7:146478663-146478685 ATGTGTGTAGAGGGGAAGAGGGG - Intronic
1033985865 7:147224767-147224789 ATGTGTATATATAGAGAGGGGGG - Intronic
1034430989 7:151041070-151041092 AATTGGGTTGAGAGGGAGGGAGG - Intronic
1034465154 7:151223648-151223670 ATGGGGGTAGGGAAGGAGGGAGG + Intronic
1034615332 7:152411448-152411470 TTGTGTGTTGAGGGGGTGGGGGG - Intronic
1035214931 7:157358461-157358483 ATGGGTCTGGAGAGGGAGGAAGG - Intronic
1035399056 7:158552915-158552937 GTTTGTGTAGACAGGGAGGCTGG - Intronic
1035399094 7:158553154-158553176 ATGTGTGTAGACAGGAAGGGTGG - Intronic
1035399140 7:158553433-158553455 GTGTGTGTAGACAAGGAGGGTGG - Intronic
1035399163 7:158553577-158553599 CTGTGTGTAGACAAGGAGGGTGG - Intronic
1035399223 7:158553919-158553941 GTGTGTTTAGACAGGGAGGGTGG - Intronic
1035642193 8:1192569-1192591 GTGGGAGTGGAGAGGGAGGGCGG - Intergenic
1035740991 8:1928625-1928647 ATCTGTGTAGGGACGGAGGAGGG + Exonic
1035894904 8:3388857-3388879 GTATGTAGAGAGAGGGAGGGAGG - Intronic
1035987703 8:4453168-4453190 CTGTGTGTTGGGATGGAGGGGGG - Intronic
1036457223 8:8920273-8920295 ATGAATGGAGGGAGGGAGGGAGG + Intergenic
1036616932 8:10395381-10395403 ATGTGTGTAGAAAGAGAGTAGGG + Intronic
1036817601 8:11913568-11913590 ATGTGCTTAGAGTGGGGGGGCGG + Intergenic
1037157915 8:15728443-15728465 GGATGTGTGGAGAGGGAGGGAGG + Intronic
1037338877 8:17820677-17820699 GTGTGTGTAGAGGGGGAGGGAGG - Intergenic
1037436472 8:18869148-18869170 GTGAGTGTGGAGAGGTAGGGAGG - Intronic
1038022843 8:23564454-23564476 ATGTGTGTTGGGGGGGAGTGGGG + Intronic
1038136989 8:24796969-24796991 ATGTTTGCAGAGATGGAGTGTGG - Intergenic
1038308134 8:26422778-26422800 GTGTGTGTAGAGGGGGGTGGGGG + Intronic
1038357489 8:26842852-26842874 GTGTGTGTAGAAAGAGAGAGAGG - Intronic
1038476928 8:27875182-27875204 AGGAGTGAAGGGAGGGAGGGAGG - Intronic
1038476937 8:27875206-27875228 AGGAGTGAAGAGAGGGAGGGAGG - Intronic
1038525674 8:28271077-28271099 TTGTCTCTAGAGAGGGAGGAAGG - Intergenic
1038695694 8:29804504-29804526 ATGTGTGTAGAGGGAGGAGGTGG - Intergenic
1039898842 8:41735951-41735973 GTGTGTGTAGGGAGAGGGGGTGG + Intronic
1040279291 8:46030057-46030079 AAGTGAGCAGCGAGGGAGGGAGG + Intergenic
1040399074 8:47029972-47029994 GTGGGGGGAGAGAGGGAGGGAGG + Intergenic
1040506614 8:48054484-48054506 ATGTGTGTATAGAGGGTTGTGGG + Intronic
1040752715 8:50729709-50729731 CTGTATGTAAAGAGGAAGGGAGG + Intronic
1040913585 8:52545500-52545522 GTGTGTGCAGGGAGGGAGGTGGG - Intronic
1041577296 8:59413508-59413530 AAGGGTGGAGAGAGGGAGGCAGG + Intergenic
1041754487 8:61299086-61299108 ATGTGTGAAGAGTGGGGGTGGGG - Intronic
1042070895 8:64931953-64931975 GTGTGTGTATAGTGGTAGGGGGG - Intergenic
1042383148 8:68142290-68142312 TTGGGTGCAGAGTGGGAGGGAGG - Intronic
1042953043 8:74220623-74220645 ATGTGTGTGGTGGGGTAGGGTGG + Intergenic
1043078599 8:75735453-75735475 ATCAATGTAGAGAGGAAGGGAGG - Intergenic
1043461122 8:80461296-80461318 ATGTGTGTAGGTAGGTAGGTAGG + Intergenic
1044063779 8:87673057-87673079 AAGTAGGTAGAGAGTGAGGGAGG - Intergenic
1044113819 8:88309417-88309439 AAGTCTATAAAGAGGGAGGGTGG + Intronic
1045535925 8:103027835-103027857 GTGTGTGCAGGGAGGGTGGGAGG - Intronic
1045723293 8:105139674-105139696 ATGTGTGTGGGGAGGGTGGTGGG + Intronic
1045978861 8:108160760-108160782 AAGTGTGTAGAAAGGAAGGATGG + Intergenic
1046053547 8:109052459-109052481 GTGTGTGTACAGAGTGTGGGCGG - Intergenic
1046193282 8:110827512-110827534 ATGTGTGTGGTGTGGGAGGAGGG - Intergenic
1046790235 8:118313901-118313923 GTGTGTGTGTAGAGGGAGAGAGG + Intronic
1047203700 8:122786717-122786739 ATGTGTGTACTGGGGGTGGGGGG - Intronic
1047215956 8:122876145-122876167 ATGGATGGAGGGAGGGAGGGAGG - Intronic
1047252700 8:123192719-123192741 ATCTGTGCAGAGGGGAAGGGAGG - Intronic
1047301485 8:123617275-123617297 ATATTTGGAGACAGGGAGGGAGG - Intergenic
1047683308 8:127277200-127277222 GTGTGTGTTGAGATGGTGGGGGG + Intergenic
1048056995 8:130876705-130876727 GTGTGTGTAGGGGGGCAGGGGGG + Intronic
1048254190 8:132893374-132893396 ATGTGTGTAGTGTGGGGGGGTGG + Intronic
1048258803 8:132927271-132927293 ATGGATGGAGGGAGGGAGGGAGG - Intronic
1048810770 8:138284000-138284022 ATGTGTGTATAGGGTGTGGGTGG + Intronic
1048920022 8:139219672-139219694 CTGAATGAAGAGAGGGAGGGAGG - Intergenic
1049014119 8:139907554-139907576 ATGGAGGCAGAGAGGGAGGGAGG + Intronic
1049055521 8:140233603-140233625 TGGTGGGGAGAGAGGGAGGGAGG - Intronic
1049079333 8:140429557-140429579 ATGTGTGTAGAGGCCGAGGTGGG + Intronic
1049203409 8:141352438-141352460 CTGTGTGTGAAGAGGCAGGGAGG + Intergenic
1049409989 8:142468799-142468821 ATGTGTGCAGAGACAGAGGCAGG - Intronic
1049569860 8:143364334-143364356 GTGTGCTTAGGGAGGGAGGGAGG - Intergenic
1049632531 8:143666386-143666408 ATGTGTGTGCACACGGAGGGAGG - Intergenic
1049632604 8:143666728-143666750 ATGTGTGTGCACACGGAGGGAGG - Intergenic
1049632625 8:143666826-143666848 ATGTGTGTGCACACGGAGGGAGG - Intergenic
1049632672 8:143667028-143667050 ATGTGTGTGCACATGGAGGGAGG - Intergenic
1049632683 8:143667074-143667096 GTGTTTGCACAGAGGGAGGGAGG - Intergenic
1049755575 8:144310001-144310023 ATGTGCGTGGAGCGGGAGGGTGG - Intronic
1050072225 9:1827366-1827388 ATGTGTGTGGTGAGGGGGGTGGG - Intergenic
1050077405 9:1879425-1879447 ATGTGACTAGAGAGGGAGCTGGG - Intergenic
1050260694 9:3837984-3838006 TTGTGTGTGGAGGGGGTGGGGGG + Intronic
1050676284 9:8058061-8058083 GTGTGTGTACAGGGAGAGGGAGG - Intergenic
1050719384 9:8568322-8568344 CTGTTAGTAGAGAGGGAGGGAGG - Intronic
1051309974 9:15759106-15759128 AAGGCTGGAGAGAGGGAGGGAGG - Intronic
1051342179 9:16121523-16121545 CGGTGTGCAGAGAGGGTGGGGGG + Intergenic
1051433054 9:17000052-17000074 GTGTGTGTAGGTGGGGAGGGTGG - Intergenic
1051796136 9:20872569-20872591 ATGGAGGGAGAGAGGGAGGGAGG - Intronic
1051909372 9:22135336-22135358 TTGTGTGAAGAGAAGAAGGGTGG + Intergenic
1052002348 9:23300413-23300435 AAGTGGGTTGAGAGGGAGAGAGG - Intergenic
1053148582 9:35728580-35728602 ATGTGTGTATAGAGAGAGTAAGG - Intronic
1053188407 9:36037849-36037871 ATGAGTGCACAGAGGGAGAGAGG + Intronic
1053416430 9:37949721-37949743 ATGTGTGCAGACATGGATGGTGG + Intronic
1053946348 9:43312793-43312815 ATGAGAGAAGGGAGGGAGGGAGG + Intergenic
1054748516 9:68880699-68880721 ATGTGTGTGGTGAATGAGGGAGG - Intronic
1054836436 9:69679398-69679420 GTGTGTGTTGAGAGAGAGAGAGG - Intergenic
1054898968 9:70347206-70347228 ATGTGTGTGTATGGGGAGGGTGG - Intronic
1055166429 9:73201014-73201036 GTGTGTGTTGGAAGGGAGGGTGG - Intergenic
1055365975 9:75545174-75545196 AGGTGGGGAGAGAGGGAGGGAGG - Intergenic
1056039531 9:82648339-82648361 GTGTGTGTAGAGAGAGAGGGAGG + Intergenic
1056613579 9:88141735-88141757 ATGTGTGCAGAGAGGATGGGAGG + Intergenic
1057261967 9:93589836-93589858 TTGTGTGGAGAGAGGGAAAGGGG - Intronic
1057279367 9:93698877-93698899 AGGTGTGGAGGGAGGGAGGGAGG + Intergenic
1057310096 9:93937354-93937376 AAGTGTGCAGGGAGGGAGGGTGG + Intergenic
1057873744 9:98737116-98737138 ATGTGTGTATAGGGGGCAGGGGG - Intronic
1057961035 9:99457668-99457690 AAACGTGGAGAGAGGGAGGGAGG + Intergenic
1058833169 9:108837507-108837529 CTGAGGGTAGAGAGGGAGGCTGG - Intergenic
1059662393 9:116414895-116414917 GAGGGTGTAGAGAGAGAGGGAGG + Intergenic
1059695938 9:116730546-116730568 TTGTGTGGAGGGAGGAAGGGAGG + Intronic
1059769585 9:117413793-117413815 AGGTGGGTAGAAAGGGAAGGCGG + Intronic
1059795337 9:117688750-117688772 ATGTGTGTGGCGGGGGTGGGGGG - Intergenic
1059835352 9:118146178-118146200 ATGGATGGAGAGAGGAAGGGAGG - Intergenic
1059902143 9:118939853-118939875 GTGTGTGTTGACAGGGAGTGGGG - Intergenic
1060018102 9:120104662-120104684 ATGCGTGTGGAGAGGGAGGTTGG + Intergenic
1060428942 9:123531540-123531562 GTGTGTGTAGAGAGAGAGGGGGG - Intronic
1060768079 9:126309809-126309831 ATGTATATAGAGCAGGAGGGGGG + Intergenic
1060827031 9:126693423-126693445 ATGTGCGGAGAGATGGAGGATGG - Intronic
1060896049 9:127218309-127218331 AGGTGTGTGCAGAGGGTGGGTGG - Intronic
1060948018 9:127581805-127581827 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060948040 9:127581886-127581908 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060948049 9:127581913-127581935 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060948081 9:127582017-127582039 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060948090 9:127582044-127582066 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060954565 9:127629375-127629397 CTGTGTGGAGAGTGGGCGGGAGG + Intronic
1061187182 9:129061353-129061375 AGGTGTGGAGGGAGGGAGGGAGG + Intronic
1061405364 9:130390716-130390738 ATGGGGGTAGAGGGGCAGGGCGG + Intronic
1061499047 9:130991813-130991835 GTGTGTGAAAGGAGGGAGGGAGG - Intergenic
1061623513 9:131826722-131826744 TTGTGTGTAGGGAGGGATGGGGG - Intergenic
1061911776 9:133728836-133728858 ATGAGTGGCTAGAGGGAGGGAGG + Intronic
1062223803 9:135437280-135437302 ATGTGGTTAGAGTGGGCGGGCGG + Intergenic
1062367542 9:136218445-136218467 GTGGGTGTAGAGAGGGGCGGGGG - Intronic
1062519493 9:136951813-136951835 ATGTGTGGAGCCAGGCAGGGTGG + Intronic
1062581637 9:137231537-137231559 CAGGGCGTAGAGAGGGAGGGTGG + Intronic
1203589478 Un_KI270747v1:41351-41373 ATGAGAGAAGGGAGGGAGGGAGG + Intergenic
1185808093 X:3078974-3078996 ATGTTTGTAGAGACGGAAAGTGG - Intronic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186137024 X:6532789-6532811 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137026 X:6532793-6532815 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137035 X:6532819-6532841 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137045 X:6532848-6532870 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137047 X:6532852-6532874 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137056 X:6532878-6532900 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137058 X:6532882-6532904 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137068 X:6532911-6532933 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137070 X:6532915-6532937 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137087 X:6532970-6532992 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137089 X:6532974-6532996 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137106 X:6533029-6533051 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137108 X:6533033-6533055 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137118 X:6533062-6533084 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137120 X:6533066-6533088 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137129 X:6533092-6533114 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137131 X:6533096-6533118 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137141 X:6533125-6533147 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137143 X:6533129-6533151 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137152 X:6533155-6533177 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137154 X:6533159-6533181 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137164 X:6533188-6533210 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137166 X:6533192-6533214 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137176 X:6533221-6533243 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137178 X:6533225-6533247 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137187 X:6533251-6533273 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137189 X:6533255-6533277 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137198 X:6533281-6533303 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137200 X:6533285-6533307 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137218 X:6533343-6533365 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137220 X:6533347-6533369 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137230 X:6533376-6533398 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137240 X:6533405-6533427 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137242 X:6533409-6533431 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137252 X:6533438-6533460 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137254 X:6533442-6533464 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137263 X:6533468-6533490 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137265 X:6533472-6533494 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137275 X:6533501-6533523 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137277 X:6533505-6533527 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137287 X:6533534-6533556 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137289 X:6533538-6533560 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186157576 X:6741619-6741641 AGGTAGGTAGATAGGGAGGGAGG + Intergenic
1186267153 X:7844201-7844223 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267155 X:7844205-7844227 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267165 X:7844234-7844256 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267175 X:7844263-7844285 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267177 X:7844267-7844289 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267187 X:7844296-7844318 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267197 X:7844325-7844347 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267199 X:7844329-7844351 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267209 X:7844358-7844380 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267211 X:7844362-7844384 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267220 X:7844388-7844410 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267222 X:7844392-7844414 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267232 X:7844421-7844443 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267234 X:7844425-7844447 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267243 X:7844451-7844473 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267245 X:7844455-7844477 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267256 X:7844484-7844506 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186297728 X:8169142-8169164 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297738 X:8169171-8169193 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297740 X:8169175-8169197 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297750 X:8169204-8169226 GTGTGGGGAGGGAGGGAGGGGGG - Intergenic
1186297754 X:8169208-8169230 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297764 X:8169237-8169259 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297766 X:8169241-8169263 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297776 X:8169270-8169292 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297778 X:8169274-8169296 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297788 X:8169303-8169325 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297790 X:8169307-8169329 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297800 X:8169336-8169358 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297802 X:8169340-8169362 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297812 X:8169369-8169391 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297814 X:8169373-8169395 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297824 X:8169402-8169424 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297826 X:8169406-8169428 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297836 X:8169435-8169457 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297838 X:8169439-8169461 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297848 X:8169468-8169490 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297858 X:8169497-8169519 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297860 X:8169501-8169523 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297870 X:8169530-8169552 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297872 X:8169534-8169556 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297882 X:8169563-8169585 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297884 X:8169567-8169589 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297894 X:8169596-8169618 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297904 X:8169625-8169647 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297906 X:8169629-8169651 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297916 X:8169658-8169680 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297926 X:8169687-8169709 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297928 X:8169691-8169713 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297940 X:8169724-8169746 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297942 X:8169728-8169750 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297952 X:8169757-8169779 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297954 X:8169761-8169783 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297964 X:8169790-8169812 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297966 X:8169794-8169816 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297978 X:8169827-8169849 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297980 X:8169831-8169853 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297992 X:8169864-8169886 TGGTGTGTGGTGAGGGAGGGAGG - Intergenic
1186324860 X:8466568-8466590 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324870 X:8466597-8466619 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324880 X:8466626-8466648 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324882 X:8466630-8466652 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324894 X:8466663-8466685 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324904 X:8466692-8466714 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324913 X:8466718-8466740 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324923 X:8466747-8466769 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324933 X:8466776-8466798 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324943 X:8466805-8466827 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324953 X:8466834-8466856 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324955 X:8466838-8466860 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324965 X:8466867-8466889 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324967 X:8466871-8466893 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324976 X:8466897-8466919 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324978 X:8466901-8466923 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324987 X:8466927-8466949 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324989 X:8466931-8466953 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324999 X:8466960-8466982 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325001 X:8466964-8466986 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325012 X:8466993-8467015 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325014 X:8466997-8467019 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325024 X:8467026-8467048 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325034 X:8467055-8467077 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325036 X:8467059-8467081 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325046 X:8467088-8467110 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325056 X:8467117-8467139 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325066 X:8467146-8467168 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325076 X:8467179-8467201 GTGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325085 X:8467205-8467227 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325095 X:8467234-8467256 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325105 X:8467263-8467285 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325115 X:8467292-8467314 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325117 X:8467296-8467318 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325131 X:8467329-8467351 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186532219 X:10308901-10308923 ATGTGTGTGGTGAGGGGAGGGGG - Intergenic
1186636235 X:11408224-11408246 ACGTGTGTAAGGAGGCAGGGAGG + Intronic
1186706100 X:12140176-12140198 ATGTTAGTAGAAAGGGAAGGTGG - Intronic
1187047219 X:15659177-15659199 GTGTGTGGAGAGAGAGAGAGAGG - Intronic
1187256457 X:17647503-17647525 AAGTGTGTGGAAAGGGAGGGTGG + Intronic
1187414201 X:19078376-19078398 TTTTTTGTAGAGATGGAGGGGGG - Intronic
1187561830 X:20410652-20410674 AGGCCAGTAGAGAGGGAGGGAGG - Intergenic
1187716776 X:22110601-22110623 ATGGCTGCATAGAGGGAGGGGGG - Intronic
1188340766 X:28998455-28998477 ATGTTTATGGAGAGGGAGGTGGG + Intronic
1188489503 X:30722771-30722793 GTGTGTGTGAAGAGAGAGGGGGG + Intronic
1188955537 X:36431596-36431618 GTGTGTGGGTAGAGGGAGGGAGG + Intergenic
1189376392 X:40469643-40469665 ACGTGTGTAAAGAGGTTGGGCGG + Intergenic
1190332772 X:49246461-49246483 ATGTGGGAAGAGAGGGGGGTGGG - Intronic
1190454760 X:50616860-50616882 GTGTGTGTGGTGAGGGATGGGGG - Intronic
1190469983 X:50769190-50769212 AGGAGTGAAGAAAGGGAGGGAGG + Intronic
1190682696 X:52841638-52841660 AGGTAGGTAGGGAGGGAGGGAGG + Intergenic
1190887990 X:54546030-54546052 ATTTTTGTAGAGATGGGGGGAGG + Intronic
1191127916 X:56977559-56977581 ATGTGTGTAGAGACACAGAGAGG - Intronic
1191822097 X:65321890-65321912 AGGGGTGTAGGGAGGGAGGAAGG + Intergenic
1191842136 X:65520882-65520904 ATGTGTATATAATGGGAGGGAGG - Intronic
1192164483 X:68818787-68818809 AGGTGGGGAGAAAGGGAGGGGGG + Intergenic
1192176406 X:68888641-68888663 ATGTGGTCAGAGAGGGAGGCAGG + Intergenic
1192423481 X:71054420-71054442 GTGTGTGTAGAGATGGGGGAGGG - Intergenic
1192442417 X:71184423-71184445 ACGTGTGTTGAGAGGGGAGGAGG - Intergenic
1192586007 X:72318668-72318690 ATGAGTGTAGAGAAGCAGGAAGG - Intergenic
1192639744 X:72850445-72850467 GTGTGTGTATGGGGGGAGGGGGG - Intergenic
1192641967 X:72870360-72870382 GTGTGTGTATGGGGGGAGGGGGG + Intergenic
1192674331 X:73179743-73179765 AGGTGTGTATAGAAGGAGTGGGG + Intergenic
1194203322 X:90981000-90981022 ATTTGTGTATAGAGTGAGGAGGG + Intergenic
1194794713 X:98197508-98197530 ATGTGTGTGGAGGGGGAGCATGG - Intergenic
1194879095 X:99227640-99227662 GTGTGTGTAGAGAGAGAGAGAGG + Intergenic
1195133417 X:101877685-101877707 GTGTGTGTGTTGAGGGAGGGCGG - Intergenic
1196025025 X:111033115-111033137 CTGTGTGTACAGAGAGAGGGAGG - Intronic
1196124025 X:112081250-112081272 GTGTGTCTAGGGAGGGAGGGAGG + Intronic
1196410279 X:115411285-115411307 TTGTGGTTAGGGAGGGAGGGAGG + Intergenic
1196588131 X:117454142-117454164 ATGGGGGGATAGAGGGAGGGAGG - Intergenic
1196936759 X:120738041-120738063 TTTAGTGTAAAGAGGGAGGGAGG - Intergenic
1197014737 X:121609768-121609790 ATGAAGGGAGAGAGGGAGGGAGG + Intergenic
1197027585 X:121773507-121773529 AAGTGGGGAGAGAGGGAGGATGG - Intergenic
1197718614 X:129728576-129728598 AGGTGGAGAGAGAGGGAGGGAGG - Intergenic
1197723454 X:129760388-129760410 GTGTGTGTAGGCAGGGTGGGGGG - Intronic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1197825157 X:130581522-130581544 ATGGGTGTAGAGAGAGACAGGGG + Intergenic
1198103351 X:133440588-133440610 ATGTGAGCAGGGAGGAAGGGGGG - Intergenic
1198160065 X:133999297-133999319 GTGTGTTTTGAGGGGGAGGGAGG + Intergenic
1198269464 X:135041627-135041649 ATGAGAGAAGGGAGGGAGGGAGG + Intergenic
1198431677 X:136573705-136573727 CTATATATAGAGAGGGAGGGAGG + Intergenic
1198495058 X:137183954-137183976 ATGTGTGTATAGAGGGGTGGTGG - Intergenic
1198719632 X:139602255-139602277 GTGTGTGTTGGGGGGGAGGGTGG + Intronic
1198804617 X:140481515-140481537 CTGTGTGTAAGAAGGGAGGGAGG + Intergenic
1198910257 X:141605728-141605750 ATATGTGGAGAGAGAGAGAGAGG - Intronic
1199598867 X:149528687-149528709 AAGAGGGTAGAGAGAGAGGGAGG - Intronic
1199814648 X:151386855-151386877 CCATGTGGAGAGAGGGAGGGAGG - Intergenic
1199825835 X:151498415-151498437 TGGTGTGTGGACAGGGAGGGAGG + Intergenic
1199854824 X:151751753-151751775 ATGTGTGTGGAGGAGGAGAGTGG + Intergenic
1200082597 X:153585890-153585912 AAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1200169251 X:154060539-154060561 AGGGGTGGGGAGAGGGAGGGAGG + Intronic
1201144719 Y:11057975-11057997 ATGAGTGGATGGAGGGAGGGAGG + Intergenic
1201438458 Y:13985038-13985060 TGGTGTGTAGGGAGGGAGGGAGG - Intergenic
1201438492 Y:13985154-13985176 TGGTGTGTAGGGAGGGAGGGAGG - Intergenic
1201438516 Y:13985245-13985267 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1201438532 Y:13985300-13985322 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1201438611 Y:13985524-13985546 TGGTGTGTAGGGAGGGAGGGAGG - Intergenic
1201438636 Y:13985609-13985631 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1201438657 Y:13985667-13985689 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1201438667 Y:13985696-13985718 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1201445906 Y:14057012-14057034 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1201445916 Y:14057041-14057063 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1201445937 Y:14057099-14057121 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1201445962 Y:14057184-14057206 TGGTGTGTAGGGAGGGAGGGAGG + Intergenic
1201446041 Y:14057408-14057430 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1201446057 Y:14057463-14057485 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1201446081 Y:14057554-14057576 TGGTGTGTAGGGAGGGAGGGAGG + Intergenic
1201446115 Y:14057670-14057692 TGGTGTGTAGGGAGGGAGGGAGG + Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic
1201691760 Y:16774963-16774985 ATGGGTGTAGGGAGGGAGGGAGG - Intergenic
1201711463 Y:16997521-16997543 ATGTTTGTAGAGAGGAAGGATGG + Intergenic
1201789642 Y:17825412-17825434 GTGTGTGTGGAGCGGGTGGGGGG - Intergenic
1201811912 Y:18080577-18080599 GTGTGTGTGGAGCGGGTGGGGGG + Intergenic
1201944287 Y:19495466-19495488 GTGTGTGTAGACAGGCAGGAGGG - Intergenic
1202351293 Y:23995162-23995184 GTGTGTGTGGAGCGGGTGGGGGG - Intergenic
1202519486 Y:25674957-25674979 GTGTGTGTGGAGCGGGTGGGGGG + Intergenic