ID: 916669737

View in Genome Browser
Species Human (GRCh38)
Location 1:167004035-167004057
Sequence GTAAAATCCTTAACAAAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 327}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916669737 Original CRISPR GTAAAATCCTTAACAAAAAC GGG Intronic
901358894 1:8678303-8678325 CTTAAATACTTAAAAAAAACAGG + Intronic
903087966 1:20881317-20881339 GTACAAAACTCAACAAAAACTGG + Intronic
903445090 1:23417917-23417939 CCAAAGTCCTTATCAAAAACTGG - Exonic
906954689 1:50363161-50363183 AGAAAATCCTCAATAAAAACTGG + Intergenic
907382882 1:54105592-54105614 CTAGAATTGTTAACAAAAACTGG - Intronic
907687609 1:56628415-56628437 GTAAAATCCTTAGCACAGAGTGG + Intronic
908392689 1:63698019-63698041 GTAGAATCATTAACTCAAACTGG - Intergenic
908964892 1:69748477-69748499 GTAAAATGCTTCACATAAAGTGG + Intronic
911811556 1:102289006-102289028 GAGAAATCCTAAAGAAAAACCGG + Intergenic
911992855 1:104724710-104724732 CTAAAATCCCTACCATAAACTGG + Intergenic
912043252 1:105418478-105418500 TGAAAATCATTAACTAAAACAGG - Intergenic
912299615 1:108501523-108501545 GTAAGATCCATAACCAAAAAGGG - Intergenic
913463309 1:119112773-119112795 TTAAATTCCAGAACAAAAACTGG - Intronic
914097711 1:144558434-144558456 GTAAAATTTTTAACAAACATTGG + Intergenic
915055330 1:153123629-153123651 TGAAAATCCCTAATAAAAACTGG - Intergenic
916369136 1:164069664-164069686 ATAAAAACCCTAACAAATACTGG - Intergenic
916669737 1:167004035-167004057 GTAAAATCCTTAACAAAAACGGG + Intronic
917349576 1:174063070-174063092 ATAAAATCGTTAGTAAAAACTGG - Intergenic
918054212 1:181004663-181004685 GTAATATCCTTTACAACAAATGG + Intronic
918603139 1:186387617-186387639 ATAAAGTCCTTAACAATAATGGG - Intronic
919445446 1:197699152-197699174 GAAAAATCCTCAAAAAATACTGG + Intronic
919568132 1:199214994-199215016 CAAAAATCCTCAACAAATACTGG - Intergenic
919613836 1:199780073-199780095 ATAAAATCATTAAGAAAAGCAGG + Intergenic
923744589 1:236687970-236687992 GTAAAAGCCTTAAGAAACTCGGG - Intronic
923757690 1:236807919-236807941 GTAAAACTATTTACAAAAACAGG + Intronic
923810157 1:237305776-237305798 GTAAAATTATAAAGAAAAACAGG + Intronic
924016220 1:239726692-239726714 GTAAAATCCTTAACAACCGCTGG + Intronic
1066652718 10:37673773-37673795 GTAAACTCCCTAACATAAAAAGG - Intergenic
1067016847 10:42763554-42763576 GTAAAAACCCTTAAAAAAACAGG + Intergenic
1067838370 10:49655632-49655654 ATAAAATCCATGTCAAAAACAGG - Intronic
1069651046 10:70049106-70049128 ATAATATCCTTAAAAAAAAAAGG - Intergenic
1069758742 10:70792813-70792835 GAAATAGCCTTAGCAAAAACTGG - Intergenic
1070303599 10:75223982-75224004 GTAATATCCTTTATTAAAACTGG + Intronic
1070621167 10:78012455-78012477 CTAAAAGCCTAAACCAAAACAGG + Intronic
1070658446 10:78287447-78287469 GAAAAATTCTTCACAAAAATGGG + Intergenic
1071472846 10:85997103-85997125 GTAAAAACCATAACATAAGCTGG + Intronic
1071536385 10:86435133-86435155 ATAAAATATTTAACAAAAACTGG + Intergenic
1072396883 10:95052753-95052775 GTAAAAGCCCTAAAAAAAACAGG + Intronic
1072839146 10:98751116-98751138 GGGAAATACGTAACAAAAACAGG - Intronic
1072934183 10:99696101-99696123 ATGAAACTCTTAACAAAAACAGG + Exonic
1074494947 10:113971957-113971979 GTGAAATACTCAACAGAAACAGG + Intergenic
1075655861 10:124160821-124160843 GTAAAAACCAAAACAAAAACTGG - Intergenic
1078785195 11:14484259-14484281 GTTAGATCCTGAACAAAAAAAGG + Intronic
1078903121 11:15660193-15660215 AAAAAATCCACAACAAAAACTGG - Intergenic
1080516277 11:33023974-33023996 GTAATATACTTAACATAAATGGG + Intronic
1080831948 11:35902998-35903020 GTCAAAGCTTTACCAAAAACTGG + Intergenic
1080988694 11:37504030-37504052 GTAACATCCTTATCAAAATCAGG + Intergenic
1081039263 11:38190943-38190965 GTGAAATTCTTAAAAAAAAATGG - Intergenic
1081569628 11:44281587-44281609 GTAATCTCCTTAAAAAAAACAGG + Intronic
1085661749 11:78374046-78374068 GTCAAATCCTTGCCAAAAATGGG - Intronic
1086187240 11:84033272-84033294 GTCAAAGTCTCAACAAAAACAGG + Intronic
1086483897 11:87276347-87276369 GTCAAGTACTTAACCAAAACTGG + Intronic
1087205507 11:95389746-95389768 GTAAAAACAAAAACAAAAACAGG - Intergenic
1087316540 11:96609942-96609964 AAAAAAACCTTATCAAAAACTGG - Intergenic
1087365937 11:97218822-97218844 GTAAAATACTTAAAAAATAAAGG - Intergenic
1087875898 11:103356830-103356852 GTAAAGTTCATAACAAAATCAGG - Intronic
1088073186 11:105814842-105814864 GGAGAATCCTTACCAAAAATGGG + Intronic
1090561811 11:127940964-127940986 TTAAAGTCCTTAACAATAAATGG - Intergenic
1090727139 11:129538394-129538416 GAAAAATCCTCAACAAATATAGG + Intergenic
1090871380 11:130752557-130752579 GAAAAATCCTTTACAATATCTGG + Intergenic
1092681187 12:10983003-10983025 GTCAAACCCGAAACAAAAACGGG + Intronic
1093734685 12:22607229-22607251 TGAAAATACTTAAGAAAAACAGG + Intergenic
1095457456 12:42403856-42403878 GTAAAATCCTTACCTAACACTGG - Intronic
1096185440 12:49577461-49577483 TTAAAATCCTCCACATAAACTGG + Intronic
1097550677 12:61064284-61064306 TTAAAATCATTAACAAACACTGG + Intergenic
1098135927 12:67401686-67401708 GTAAAACTATTGACAAAAACAGG - Intergenic
1099021315 12:77408010-77408032 GTAAAACCTTTAAGAAATACAGG - Intergenic
1099358941 12:81673801-81673823 TTAAAATCCTTTTCAGAAACAGG + Intronic
1099703441 12:86119398-86119420 GAAAAATACTTAATGAAAACGGG - Intronic
1100993113 12:100271371-100271393 GTTAAATACTTCACAAAATCTGG - Intronic
1101225583 12:102685036-102685058 GAAGAATGCTTAACATAAACAGG - Intergenic
1103247798 12:119472882-119472904 GGAAAGTCCTTTACAAAAAAAGG - Intronic
1103330822 12:120153080-120153102 GGTGAATCCTTAACAAGAACTGG + Intronic
1104145228 12:126026956-126026978 GTAAAATCTTTAAATAAAATGGG - Intergenic
1105642339 13:22278722-22278744 GTAAAATACTTCATGAAAACTGG + Intergenic
1106184647 13:27398660-27398682 GAAAAAACTTTAACAGAAACTGG - Intergenic
1106238930 13:27892383-27892405 TTAAAATCCTCAAAAAATACTGG - Intergenic
1106289972 13:28351748-28351770 GTTAAATCCTTAAGTCAAACAGG + Intronic
1108173635 13:47769975-47769997 GCATCATCCTTAACAAAACCTGG - Intergenic
1111007672 13:82269739-82269761 GTAAAATACTTACCATAAATAGG - Intergenic
1111534040 13:89578124-89578146 GTAAAAACATTAATAAAAAAAGG - Intergenic
1111847180 13:93525653-93525675 TTAAAGTACTTAACAAAAAAAGG + Intronic
1111900946 13:94199155-94199177 GTAAAGTTCTTCACAAACACGGG - Intronic
1112762046 13:102702566-102702588 GTAAGATCCTGTACAAAAACAGG + Intergenic
1113588459 13:111481765-111481787 GTAAAATGCTTATTATAAACTGG + Intergenic
1114286483 14:21249215-21249237 GCAAAACCCTAAGCAAAAACTGG + Intronic
1114439581 14:22735342-22735364 GAAATAGCCTTAGCAAAAACTGG + Intergenic
1115388727 14:32828889-32828911 AGAAAAACCTTAACAAAAAGTGG - Intronic
1115543863 14:34447609-34447631 GTAAGAACCTGAACAAAAAGGGG + Intronic
1115793885 14:36910809-36910831 GTAAAATTCTTAACTGAACCAGG + Intronic
1116177763 14:41494837-41494859 CGAAAATCCTCAATAAAAACTGG + Intergenic
1117976834 14:61307095-61307117 GTAATTTTCTTAACAACAACAGG + Intronic
1118179360 14:63476101-63476123 GTAAAAGCATTAACACAAGCTGG + Intronic
1118420019 14:65591979-65592001 GCAAGATACTTAAAAAAAACTGG + Intronic
1119153943 14:72391324-72391346 AAAAAATCATTAGCAAAAACTGG + Intronic
1120637350 14:86968458-86968480 ACAAAATCCTTAACAAAAAGTGG - Intergenic
1121062352 14:90924949-90924971 GTAAAATCATCAATGAAAACAGG + Intronic
1121418349 14:93794849-93794871 GGAGAATCCTTACCAGAAACTGG + Intergenic
1121797777 14:96749621-96749643 ATAAAATGCATAACAAAGACCGG - Intergenic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1124202650 15:27691526-27691548 GTAAAATCTTTGACAAACACTGG + Intergenic
1126532245 15:49723984-49724006 GTAAAACCATAAACAAAATCAGG - Intergenic
1126535333 15:49756001-49756023 GTAAAATAATTAACAAACAAAGG + Intergenic
1127242663 15:57134948-57134970 TTAATATCCATGACAAAAACAGG - Intronic
1128956494 15:71952060-71952082 GGAAAATGCTTAAAAATAACAGG + Intronic
1129572556 15:76704202-76704224 GTAAATTGCTTAGTAAAAACAGG + Intronic
1129967241 15:79747492-79747514 CAAAAATCCTCAATAAAAACTGG - Intergenic
1130400564 15:83549128-83549150 GTAAAATTTTTATCAAAAATTGG - Intronic
1130533020 15:84761971-84761993 GCACAACCCTTATCAAAAACAGG - Intronic
1130680770 15:85994480-85994502 GTAAAATTTTTAAAAAAAAAAGG - Intergenic
1131869912 15:96753087-96753109 ATAAAATTCATAACAAAAATAGG + Intergenic
1132239958 15:100249857-100249879 TTAAAACACTTAACAATAACAGG + Intronic
1132752155 16:1463224-1463246 GTAAAATTCTTAGGAAAAAACGG + Intronic
1132967098 16:2663142-2663164 GAAAAATTCTTAACAGAAAAAGG - Intergenic
1133507718 16:6428600-6428622 GTAAAGTACTTAACACACACTGG + Intronic
1134276094 16:12777633-12777655 GGAAAATCCTTAAGAGATACAGG - Intronic
1136035637 16:27537876-27537898 GAAAAATTTTGAACAAAAACGGG - Exonic
1137950667 16:52780665-52780687 ATAAAACCATTTACAAAAACAGG - Intergenic
1139087762 16:63608970-63608992 GTAAAATTCTTAACTCAAAATGG + Intergenic
1140315240 16:73889900-73889922 TTAAAGTCCTTAACAATAACAGG + Intergenic
1142910935 17:3090354-3090376 GTAAACTACTAAACAAAATCAGG - Intergenic
1146148782 17:30447899-30447921 GTAAAGACCTTAACTACAACAGG - Intronic
1147681411 17:42249626-42249648 GTAAAACACATAACAAAAAGGGG + Intronic
1148277115 17:46314745-46314767 GAAAAATGCTTGACAAAATCTGG - Intronic
1148299231 17:46532321-46532343 GAAAAATGCTTGACAAAATCTGG - Intronic
1148363850 17:47037527-47037549 GAAAAATGCTTGACAAAATCTGG - Intronic
1149231539 17:54540281-54540303 ATAAAAACCATAAAAAAAACTGG + Intergenic
1150190078 17:63229325-63229347 GAAAAATCCTCAAAAAATACTGG - Intronic
1150547828 17:66179870-66179892 ATAAAAACCCTAAAAAAAACTGG - Intronic
1151809048 17:76425382-76425404 CTAAAAGGCTTAACAAAAACAGG + Intronic
1153535956 18:6101430-6101452 ATAAAATCCTTAACATTAAAAGG - Intronic
1154504117 18:15017843-15017865 ATAAAATCCATAACATACACCGG + Intergenic
1155121587 18:22826164-22826186 GTAAAATCTTTAACAAAGATAGG - Intronic
1156526506 18:37772941-37772963 GTAAAATCCTTGCTAAAAAATGG + Intergenic
1156588096 18:38455157-38455179 ATAAACTCCATAACAAAAGCAGG + Intergenic
1156726284 18:40132056-40132078 ATAAAATCTTTAACATAAAGGGG + Intergenic
1156863212 18:41862492-41862514 ATATAATACTTAACCAAAACAGG + Intergenic
1159639841 18:70850685-70850707 GTAAAATCCTTTAGAAAGATGGG - Intergenic
1159710739 18:71756082-71756104 ATAAAAACCTTCAAAAAAACTGG + Intronic
1160098202 18:75895501-75895523 GTAAAATACTGAACATAAATTGG + Intergenic
1160302296 18:77693831-77693853 GTAACATCCTTCAGAAAAAGTGG - Intergenic
1164096573 19:22015372-22015394 TTAAAATCCTCAGCAAAATCGGG - Intergenic
1164116078 19:22219998-22220020 TTAAAATCCTCAGCAAAATCGGG - Intergenic
1164199775 19:23007498-23007520 TTAAAATCCTCAGCAAAATCGGG - Intergenic
1164446484 19:28322089-28322111 ATAAAAGCCATAAAAAAAACTGG + Intergenic
1164611804 19:29637389-29637411 CTGACATCCTTAACAAAAAATGG + Intergenic
1164764406 19:30752886-30752908 GGAACATCCTTTACAGAAACTGG + Intergenic
1164791330 19:30986090-30986112 TTAAAATCCTTCACAAATAAAGG - Intergenic
1165125416 19:33592371-33592393 GTAAAATTTATTACAAAAACAGG - Intergenic
1165222190 19:34325516-34325538 GTCCAATCCTTAAGAAAACCCGG + Intronic
1166397150 19:42449817-42449839 GTCAGATTCTTAACAAGAACGGG + Intergenic
1202665158 1_KI270708v1_random:111753-111775 TCAAAATCCCTAATAAAAACTGG - Intergenic
926665139 2:15513427-15513449 GTAAAATATTTCACAAAAAAAGG + Intronic
929447426 2:42012157-42012179 GTAAAATGCTAAACACAAAATGG - Intergenic
929524273 2:42685747-42685769 GTCAAACCCTTAAAATAAACAGG + Intronic
931076383 2:58718031-58718053 GTAAAACCTTTCCCAAAAACAGG - Intergenic
931097922 2:58962857-58962879 GTAAAATGATTACCACAAACAGG - Intergenic
932513340 2:72318263-72318285 GTAAAATCAATAACAAAAAAAGG + Intronic
932539196 2:72633974-72633996 GTAAAATCTTTAAAATAAATAGG + Intronic
933124138 2:78583034-78583056 GTAAAATACATAACAAAGTCAGG - Intergenic
937005033 2:118503687-118503709 GTAAAATCTTTAAGAAAGACTGG + Intergenic
938129683 2:128703266-128703288 CAAGAATCCTTAACCAAAACTGG - Intergenic
938652798 2:133401155-133401177 AAAAAATCCTAAACGAAAACAGG + Intronic
938958152 2:136317804-136317826 CTAAAGCCCTTAACAAAAGCTGG + Intergenic
939745622 2:145962731-145962753 TTATAATCCTTAACAAAAACAGG + Intergenic
939910699 2:147978703-147978725 CAAAAATCCTCAACAAATACTGG + Intronic
940084576 2:149844435-149844457 ATAAAATTCTTGACAAGAACTGG + Intergenic
940430333 2:153582983-153583005 ATAAAATGATAAACAAAAACAGG + Intergenic
940711137 2:157164860-157164882 GAAAAAGCCGTAACACAAACAGG - Intergenic
941549280 2:166894730-166894752 ATAAACTACTGAACAAAAACTGG + Intronic
941851420 2:170186303-170186325 ATAAAAACCCTAAAAAAAACTGG - Intronic
942136682 2:172933120-172933142 GAAAACTCATTCACAAAAACAGG + Intronic
942592469 2:177560638-177560660 GTAAAATCCTGAACAAAGAAGGG - Intergenic
942770303 2:179509654-179509676 GTAAAATGTTTGACAAAAGCAGG + Intronic
942813958 2:180029631-180029653 TAAAAATCCTCAAAAAAAACTGG - Intergenic
943626572 2:190207936-190207958 GTAAAATAATTAATAAAAACAGG + Intronic
943686306 2:190822164-190822186 GCAAAATCCTTAACCACAGCAGG - Intergenic
943749091 2:191493408-191493430 ATAAAATAATTAACAAAACCAGG - Intergenic
944029602 2:195218736-195218758 GTAAGCTCCATAACAAAACCAGG - Intergenic
944370928 2:198982885-198982907 CAAAAATCCTCAACAAATACTGG + Intergenic
944699112 2:202230343-202230365 GTAAAACCTTTAAAAATAACTGG + Intronic
945279685 2:208024523-208024545 GAAAATGCCTTAACAAAAGCTGG - Intronic
945452388 2:210008592-210008614 CTTAAATCTTTAACAAAACCGGG - Intronic
945780322 2:214163071-214163093 TTAAAATCCTTAACCACAAATGG + Intronic
945791103 2:214306769-214306791 CAAAAATCCTAAACAAATACTGG - Intronic
947141674 2:227024597-227024619 AGAAAATCCTTAACAAAATGTGG + Intronic
947181338 2:227413944-227413966 GAAATCTCCTTTACAAAAACAGG - Intergenic
947415016 2:229886003-229886025 GTACAATCTTAAAGAAAAACGGG + Intronic
1168991416 20:2099187-2099209 ATAAAAACCCTAAAAAAAACTGG + Intergenic
1169320198 20:4626055-4626077 GTAAAATCCTTTATAATAAATGG - Intergenic
1171080575 20:22178802-22178824 CTAAGATTCTTAACAAATACTGG + Intergenic
1172087461 20:32398441-32398463 GAAAAATGCTTAATAAATACGGG - Intronic
1175138629 20:56843253-56843275 GAAAAATCTGTAACACAAACAGG + Intergenic
1175359995 20:58402139-58402161 TTAAATTCTTTAACAAAACCTGG + Intronic
1175427229 20:58876000-58876022 GTTATATCCTTAGGAAAAACTGG + Intronic
1176451484 21:6866044-6866066 TTAAAGTCCTTAATAAAAACCGG + Intergenic
1176829652 21:13731095-13731117 TTAAAGTCCTTAATAAAAACCGG + Intergenic
1177963002 21:27692316-27692338 GGAAAATTCTGAAAAAAAACTGG - Intergenic
1177993113 21:28062091-28062113 GTAAAATCCATAACATACACCGG - Intergenic
1178165953 21:29977260-29977282 GAAAAATCCTAAACAATGACTGG + Intergenic
1180331879 22:11488673-11488695 TCAAAATCCCTAATAAAAACTGG - Intergenic
1180610330 22:17092292-17092314 GTGATATCCTTAAAATAAACTGG + Intronic
1182936013 22:34222293-34222315 ATAAAATCCTTAAAAAAAATAGG - Intergenic
949369868 3:3323087-3323109 GTAAAATCCTTGTCTCAAACTGG + Intergenic
949686146 3:6573815-6573837 ATAAAATGCCTTACAAAAACAGG - Intergenic
950323692 3:12083566-12083588 GGAAAATCCTTAGAAAATACTGG + Intronic
951570343 3:24055892-24055914 CAAAAATCCTCAATAAAAACTGG - Intergenic
952877179 3:37956048-37956070 TTAAAATCCTTAAGACAAGCCGG + Intronic
953113351 3:39966215-39966237 GCCAAATCATTATCAAAAACAGG + Intronic
955699025 3:61664943-61664965 GAAAAATTCTGAACCAAAACAGG - Intronic
956805483 3:72806319-72806341 GTAAAATGGTCAGCAAAAACAGG + Intronic
957043290 3:75353841-75353863 GTACAAAACTTAACACAAACTGG - Intergenic
957090761 3:75727830-75727852 TCAAAATCCCTAATAAAAACTGG + Intronic
957522582 3:81338342-81338364 GTGAAATGCTTAACAGACACTGG + Intergenic
958597636 3:96249609-96249631 TTAAAAACATTAAAAAAAACTGG - Intergenic
958865398 3:99495335-99495357 CAAAAATCCTTAAAAAACACTGG + Intergenic
959052041 3:101533815-101533837 GAAATAGCCTTAGCAAAAACTGG - Intergenic
959842039 3:110988345-110988367 ATAAAAACCCTAAAAAAAACTGG + Intergenic
960066758 3:113382641-113382663 GTAAAATATTGAAAAAAAACTGG + Intronic
960456407 3:117878282-117878304 GTAAAATCCTTTATAATAAGTGG + Intergenic
961596248 3:128020003-128020025 GTAAAATCCTTCACAAATAAAGG - Intergenic
962664855 3:137643574-137643596 TTAAAATCCTTACCACAATCTGG - Intergenic
963024584 3:140906328-140906350 GTAAAGTCCTAGACAACAACAGG - Intergenic
963800118 3:149667782-149667804 CTAAAATCATTCACAAAAAATGG - Intronic
963913563 3:150836819-150836841 CAAAAATCCTCAACAAATACTGG - Intergenic
964078995 3:152728048-152728070 GTAAAATCCTATAGAAAAAAAGG - Intergenic
964904483 3:161702529-161702551 ATAAAAACCCTAAAAAAAACTGG + Intergenic
965309523 3:167112181-167112203 TTAAAATCCTTTCCAAAATCAGG - Intergenic
965793984 3:172419125-172419147 GTAAAAACCCTCAAAAAAACTGG - Intergenic
965985944 3:174753380-174753402 ATAAAATCCTTAAGAAAAAAAGG - Intronic
967458344 3:189716328-189716350 GTAAAATCATTAAAACAAAATGG - Intronic
970173605 4:13314019-13314041 ATAAAACCATTAACAAAAATAGG - Intergenic
970413956 4:15838144-15838166 GTAAAATCTTTGACAAAAACAGG + Exonic
970563961 4:17312691-17312713 TCAAAATCCTTTAAAAAAACAGG - Intergenic
971944923 4:33262206-33262228 ATAATATCCTCAACAAAGACTGG + Intergenic
972407528 4:38761215-38761237 GTAAATTCTGTAACAAAATCTGG - Intergenic
973700889 4:53536047-53536069 GTAAAATGCTTATTAAAAACAGG - Intronic
974085777 4:57259582-57259604 CAAAAATCCTTAACAAAATATGG - Intergenic
974363830 4:60918920-60918942 GAAAAATCCTCAATAAAAACTGG + Intergenic
974446942 4:61996526-61996548 GTAAAATGGTTAATCAAAACAGG + Intronic
974601903 4:64094120-64094142 GTAAAATGCTTTACAAAAGGAGG - Intergenic
974649417 4:64734844-64734866 GTGAAAGCCTGAACAAAAAGGGG + Intergenic
974892720 4:67901267-67901289 GTGAAATCCATAAGAGAAACAGG + Intergenic
976363767 4:84210410-84210432 ATAAAATCCTTCAACAAAACAGG + Intergenic
977322456 4:95535271-95535293 GTAAAATTCTTAAAATAAATTGG - Intronic
978024014 4:103849461-103849483 TTGAAACCCTTAATAAAAACTGG + Intergenic
978070848 4:104466775-104466797 ATAGTATCCTTAACACAAACAGG + Intergenic
979125105 4:116960642-116960664 GTAAATATTTTAACAAAAACGGG - Intergenic
979998080 4:127457023-127457045 TTAAAATACTTACCAAAAATTGG + Intergenic
980423379 4:132593237-132593259 TTTACATCCTAAACAAAAACAGG + Intergenic
980531836 4:134066721-134066743 TTAAAAGCCTTCAAAAAAACAGG - Intergenic
980747584 4:137039326-137039348 ATAAAAACCTAAAGAAAAACCGG + Intergenic
982400769 4:154965360-154965382 ATAAAATCCTTTAAAAAATCGGG + Intergenic
982618189 4:157668732-157668754 GTAATAATCTTAACAAGAACTGG - Intergenic
982944516 4:161603049-161603071 GTAAAATGCATAACAACAACAGG + Intronic
984237432 4:177177183-177177205 GTTAAATTGTTAACAAAACCTGG + Intergenic
988875048 5:35435006-35435028 TTAAGATCCTTAATAAAAACAGG - Intergenic
989371536 5:40714822-40714844 GTAAGATCTTTAACATAAAGTGG + Exonic
989976954 5:50598512-50598534 CAAAAATCCTCAATAAAAACTGG - Intergenic
989993991 5:50805085-50805107 ATAAAATCTTTAAAAGAAACTGG - Intronic
990290853 5:54349948-54349970 GCAAAATCCTTCACAAATAAAGG - Intergenic
990613224 5:57481206-57481228 CTAAAATATTTAACAAGAACAGG - Exonic
992584953 5:78229092-78229114 ATAAAATCCTAAAAAAAAGCCGG - Intronic
993277537 5:85879807-85879829 CCAAAATCCTTAAAAAATACTGG - Intergenic
994671813 5:102771106-102771128 CCAAAATGCTTAACGAAAACTGG - Intronic
994854142 5:105095298-105095320 ATAAAAGCCTTAAAAAAAACTGG + Intergenic
996201686 5:120683573-120683595 GTAAAATAATTAAAAATAACAGG - Intronic
996688129 5:126307401-126307423 GTAAAAACCTTCACAAAACTAGG + Intergenic
996752335 5:126901418-126901440 GTAAAATTCTTTGCACAAACAGG + Intronic
997086822 5:130810183-130810205 GTAAATTCATTAAACAAAACAGG - Intergenic
1000543206 5:162566664-162566686 GAAAAATCATTAAGACAAACTGG - Intergenic
1002686151 5:181011753-181011775 CGAAAATCCTCAACAAAAATGGG + Intergenic
1005184169 6:23145310-23145332 GTAAAAACCTAAACAAATAACGG + Intergenic
1005594792 6:27368672-27368694 GAAAAAGCTTTAACACAAACAGG + Intergenic
1005760766 6:28965681-28965703 TTAAAATTCTTAGCAAAATCGGG + Intergenic
1007922749 6:45625635-45625657 GGATAATCCTTAAAAATAACTGG - Intronic
1008167382 6:48155055-48155077 CAAAAATCCTTAACAAAACACGG + Intergenic
1008358382 6:50584653-50584675 GTTAAATCCTTAACAGAATGTGG - Intergenic
1008674245 6:53802523-53802545 GTAAGATGCTCAACAAAACCTGG + Intronic
1009231406 6:61066302-61066324 TTAAAATTCTTAGAAAAAACTGG - Intergenic
1010254048 6:73737980-73738002 ATAAAGTCCTTAACACATACTGG - Intronic
1010725323 6:79326595-79326617 TTAAAGTCCTTAACAATAAATGG - Intergenic
1012101283 6:95088691-95088713 GTATAATCCTTAGCATTAACTGG + Intergenic
1013800300 6:113933873-113933895 ATATAATCCTTAATAATAACAGG - Exonic
1015053084 6:128865470-128865492 GTAAAATCCTTATGAATTACGGG - Intergenic
1015863175 6:137701734-137701756 GTACATTCCTTACCAAAATCTGG + Intergenic
1020240053 7:6387309-6387331 GTGAAACCCGTAACACAAACAGG - Intronic
1021183395 7:17534364-17534386 GGAAAATCATTAAGAAAAACAGG + Intergenic
1021318852 7:19186219-19186241 CAAAAATCCTAAACAAATACTGG + Intergenic
1021335962 7:19403028-19403050 CAAAAATCCTTAAGAAAAATGGG + Intergenic
1021664640 7:22963730-22963752 GCAAAAAACTTGACAAAAACAGG + Intronic
1021794075 7:24236010-24236032 GAAACAGCCTTAGCAAAAACTGG + Intergenic
1021867289 7:24970954-24970976 GTAAAAGCCTTTAGAAAACCGGG + Intronic
1021933005 7:25600334-25600356 GTAAAGCCTTAAACAAAAACTGG + Intergenic
1024316261 7:48020270-48020292 ATAAAAACCCTAAAAAAAACTGG + Intronic
1024404992 7:48968895-48968917 GTAAAATAATTCACTAAAACTGG + Intergenic
1024856982 7:53794088-53794110 GTAAAAGCTGTAACACAAACAGG - Intergenic
1024888727 7:54177245-54177267 GAAAAATCCTAAATAAAAAATGG + Intergenic
1026842964 7:73680990-73681012 GTAAAATCCTTAGGTAAAATGGG - Exonic
1027659219 7:80968947-80968969 GTAAAATCCTTTACATAAAAAGG - Intergenic
1027680974 7:81221775-81221797 GTGACATCCTTCACAGAAACAGG - Intergenic
1028278648 7:88892726-88892748 GTACAAAGTTTAACAAAAACAGG - Intronic
1028432330 7:90761922-90761944 ATAATATGCTTAATAAAAACAGG - Intronic
1028515031 7:91668648-91668670 GTGAAATGGTTAAAAAAAACAGG - Intergenic
1028659000 7:93245723-93245745 CTAAAAGCCTGAAGAAAAACAGG + Intronic
1030120370 7:106104524-106104546 TGAAAATCCTAAACAAAACCAGG - Intronic
1032576951 7:133064691-133064713 GTGATATACTTAACACAAACTGG + Intronic
1032990438 7:137389098-137389120 ATATAATCCTTAACACAAACTGG - Intronic
1035218083 7:157385590-157385612 TTAAAGTCCTTAACAATAAATGG + Exonic
1036023527 8:4876415-4876437 GTAAAGATCTTTACAAAAACAGG - Intronic
1037197617 8:16210326-16210348 GAAAAATCTATATCAAAAACAGG - Intronic
1039009543 8:33077689-33077711 GTAAAAGCCAAAACATAAACAGG + Intergenic
1039391356 8:37183344-37183366 GTAAATTCCTAATAAAAAACTGG - Intergenic
1039623892 8:39027779-39027801 GTGATATCTTTAACAAATACAGG + Intronic
1041228336 8:55723551-55723573 GTAAAATTGTTAACAAAAATGGG + Intronic
1041332759 8:56745734-56745756 GTAAAATTCTTCACAACATCTGG - Intergenic
1042159315 8:65876185-65876207 TTAAAATACTTGACCAAAACAGG - Intergenic
1043088865 8:75872778-75872800 GGAAAATCCTCAATAAATACTGG - Intergenic
1043541707 8:81270523-81270545 CTAAACTCCTTAACAACAAGAGG - Intergenic
1044499024 8:92929266-92929288 GTAATGTCATTAACAAAAACAGG + Intronic
1044699463 8:94952809-94952831 ATAAAATCCTTAAAATAAAAAGG + Intronic
1045085098 8:98673635-98673657 ATAAAATGCTTAACAAGTACCGG + Intronic
1045911193 8:107412368-107412390 GTGAATTCCTGAACAAAATCAGG + Intronic
1045981997 8:108200532-108200554 GTAAAACTATTTACAAAAACAGG - Intergenic
1046121773 8:109856311-109856333 GTAATATCCTTTACAATAAATGG - Intergenic
1046909085 8:119606167-119606189 GTAAAATACTTCAAAAAAAAGGG + Intronic
1046989309 8:120432160-120432182 ATAAAAACCTTAAGAAAAAGTGG + Intronic
1048071694 8:131028162-131028184 GAAAAACCCATAGCAAAAACAGG + Intronic
1050314918 9:4391437-4391459 GGAAAAACCTTAATGAAAACAGG - Intergenic
1050432022 9:5571813-5571835 GTAAAATGCTTAACAATATTGGG - Intergenic
1050832571 9:10031749-10031771 GTAAACTCCATAAAAAAAATAGG - Intronic
1051816361 9:21111398-21111420 TTAAATTACTTAACAAAAATGGG - Intergenic
1052207727 9:25863724-25863746 GAAAAATCCTTGACAAGAAAGGG - Intergenic
1052292806 9:26863719-26863741 GCAAAATTCTTAACCCAAACTGG - Intronic
1052528088 9:29647510-29647532 GCAAAAGCCTTAAAAAAAACAGG - Intergenic
1052633300 9:31068823-31068845 TTAAAATCCTGAACTAAAGCTGG + Intergenic
1052661413 9:31437370-31437392 GTAAAATAGTTAAGAAATACTGG - Intergenic
1053226732 9:36365221-36365243 CTAAGAGCCTTAAAAAAAACGGG + Intronic
1053407365 9:37888938-37888960 GTAAAATCATTAGAAAAAAATGG + Intronic
1055140369 9:72870389-72870411 GTAAAATCTTTAAAGAAAAAAGG - Intergenic
1059494929 9:114701638-114701660 CTAAATTACTTAATAAAAACAGG - Intergenic
1062701920 9:137911239-137911261 GTAAACTATTAAACAAAAACAGG - Intronic
1203517697 Un_GL000213v1:18473-18495 TTAAAGTCCTTAATAAAAACCGG - Intergenic
1203486856 Un_GL000224v1:64161-64183 TCAAAATCCCTAATAAAAACTGG - Intergenic
1203499476 Un_KI270741v1:6061-6083 TCAAAATCCCTAATAAAAACTGG - Intergenic
1185916683 X:4043397-4043419 ATATAAGCATTAACAAAAACTGG + Intergenic
1186658265 X:11639933-11639955 TTAAAATTTTTAACAAAAAATGG - Intronic
1188339923 X:28986739-28986761 GTAAATTTCTAAAGAAAAACGGG - Intronic
1188530384 X:31133852-31133874 GTAAAATACTTGACAAATAGAGG + Intronic
1188902767 X:35754340-35754362 GTAAAATCAATAACATAAAGTGG + Intergenic
1188972922 X:36639224-36639246 GCAAAATCATTTAGAAAAACTGG - Intergenic
1189406467 X:40729807-40729829 GTAAAACCCTTGACATACACTGG - Intronic
1189906732 X:45768557-45768579 TTAAAATCCTTAACTCAAAAGGG - Intergenic
1190366777 X:49702318-49702340 GTAAACTCCGTAGCAAAAGCTGG + Intergenic
1190716621 X:53109578-53109600 GTAAAATACTTAGGAATAACCGG - Intergenic
1191130187 X:56999554-56999576 GTAATATCCTTTACAATAAATGG + Intergenic
1192655856 X:72993628-72993650 ATAAAAACCCTCACAAAAACTGG + Intergenic
1192725552 X:73747775-73747797 ATAAAAACCCTAAAAAAAACTGG - Intergenic
1193746833 X:85292337-85292359 CAAAAATCCTCAACAAATACTGG - Intronic
1194247277 X:91531192-91531214 ATAAAATCCTTAAAAAAAACTGG - Intergenic
1195508599 X:105687812-105687834 CGAAAATCCTCAATAAAAACTGG + Intronic
1196706112 X:118718681-118718703 TTAAACTCATTCACAAAAACCGG + Intergenic
1198420593 X:136467870-136467892 GGAAAAACCTTAACAAAATCTGG - Intergenic
1198634385 X:138679386-138679408 ATAGAATCCTTAATAAAAAATGG - Intronic
1198872146 X:141187668-141187690 ATAAAAACCCTAAAAAAAACTGG - Intergenic
1199311301 X:146323800-146323822 GTACAATCTTTAAAAAAAAATGG + Intergenic
1199363096 X:146945218-146945240 GAAATAACCTTAGCAAAAACTGG - Intergenic
1199447762 X:147945720-147945742 GTAAAATATTTCACATAAACTGG - Intronic
1200566298 Y:4772729-4772751 ATAAAATCCTTAAAAAAAACTGG - Intergenic