ID: 916671958

View in Genome Browser
Species Human (GRCh38)
Location 1:167029765-167029787
Sequence CGGGGTGGCTGCCGGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916671958_916671965 -10 Left 916671958 1:167029765-167029787 CCCTCTACCCGGCAGCCACCCCG No data
Right 916671965 1:167029778-167029800 AGCCACCCCGTCTGGGAGGTCGG 0: 22
1: 235
2: 1698
3: 5172
4: 3023
916671958_916671982 29 Left 916671958 1:167029765-167029787 CCCTCTACCCGGCAGCCACCCCG No data
Right 916671982 1:167029817-167029839 GCCAGCCGCCCAGTCCGGGAGGG 0: 155
1: 4180
2: 2682
3: 1711
4: 877
916671958_916671981 28 Left 916671958 1:167029765-167029787 CCCTCTACCCGGCAGCCACCCCG No data
Right 916671981 1:167029816-167029838 TGCCAGCCGCCCAGTCCGGGAGG No data
916671958_916671977 24 Left 916671958 1:167029765-167029787 CCCTCTACCCGGCAGCCACCCCG No data
Right 916671977 1:167029812-167029834 GCCCTGCCAGCCGCCCAGTCCGG No data
916671958_916671979 25 Left 916671958 1:167029765-167029787 CCCTCTACCCGGCAGCCACCCCG No data
Right 916671979 1:167029813-167029835 CCCTGCCAGCCGCCCAGTCCGGG No data
916671958_916671969 -7 Left 916671958 1:167029765-167029787 CCCTCTACCCGGCAGCCACCCCG No data
Right 916671969 1:167029781-167029803 CACCCCGTCTGGGAGGTCGGGGG No data
916671958_916671966 -9 Left 916671958 1:167029765-167029787 CCCTCTACCCGGCAGCCACCCCG No data
Right 916671966 1:167029779-167029801 GCCACCCCGTCTGGGAGGTCGGG No data
916671958_916671968 -8 Left 916671958 1:167029765-167029787 CCCTCTACCCGGCAGCCACCCCG No data
Right 916671968 1:167029780-167029802 CCACCCCGTCTGGGAGGTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916671958 Original CRISPR CGGGGTGGCTGCCGGGTAGA GGG (reversed) Intergenic
No off target data available for this crispr