ID: 916674659

View in Genome Browser
Species Human (GRCh38)
Location 1:167055198-167055220
Sequence TTCTGGTAACACTCCATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916674654_916674659 5 Left 916674654 1:167055170-167055192 CCCAGCCAGGGGAGCAGCAGCTA 0: 1
1: 0
2: 2
3: 32
4: 265
Right 916674659 1:167055198-167055220 TTCTGGTAACACTCCATGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 98
916674655_916674659 4 Left 916674655 1:167055171-167055193 CCAGCCAGGGGAGCAGCAGCTAC 0: 1
1: 0
2: 4
3: 26
4: 259
Right 916674659 1:167055198-167055220 TTCTGGTAACACTCCATGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 98
916674656_916674659 0 Left 916674656 1:167055175-167055197 CCAGGGGAGCAGCAGCTACCAGC 0: 1
1: 0
2: 1
3: 31
4: 291
Right 916674659 1:167055198-167055220 TTCTGGTAACACTCCATGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 98
916674653_916674659 8 Left 916674653 1:167055167-167055189 CCTCCCAGCCAGGGGAGCAGCAG 0: 1
1: 0
2: 9
3: 65
4: 579
Right 916674659 1:167055198-167055220 TTCTGGTAACACTCCATGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 98
916674651_916674659 16 Left 916674651 1:167055159-167055181 CCGGGTCTCCTCCCAGCCAGGGG 0: 1
1: 0
2: 2
3: 52
4: 421
Right 916674659 1:167055198-167055220 TTCTGGTAACACTCCATGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916674659 Original CRISPR TTCTGGTAACACTCCATGAA AGG Intronic
903315570 1:22502114-22502136 TTCTGTTTAAACTCTATGAAAGG - Intronic
913481219 1:119291130-119291152 TTCTGGTAGTACTCCCTGAAGGG - Intergenic
916674659 1:167055198-167055220 TTCTGGTAACACTCCATGAAAGG + Intronic
920078693 1:203356012-203356034 TTCAGGTATCTCTCCCTGAACGG - Intergenic
921858264 1:220012806-220012828 TTCTGGTAGCACTAAGTGAAGGG + Intronic
922491054 1:226017133-226017155 TTCTGATAACAGCCCATGGAAGG + Intergenic
924841833 1:247719294-247719316 TTCTGGTCACCATTCATGAATGG + Intergenic
1063549595 10:7017734-7017756 TTCTGCAAAAACCCCATGAAGGG + Intergenic
1065405869 10:25363667-25363689 CTCTGGCATCACCCCATGAAAGG - Intronic
1068698480 10:59994969-59994991 TTAGGGTAAAACTCCAGGAAAGG - Intergenic
1075439376 10:122467304-122467326 GTCAGGTAACACCCCAGGAAGGG - Intronic
1080451797 11:32384227-32384249 ATCTGGTAACAGTCCATCTACGG + Intergenic
1083982521 11:66184877-66184899 TTCTGGGAACACTCTATCAGCGG + Intronic
1086060214 11:82692640-82692662 TTCTGGGAACTCTCCTTGATTGG - Intergenic
1086150591 11:83605861-83605883 TTCTGCTATCAAGCCATGAAAGG + Intronic
1088126318 11:106428503-106428525 TTCTGGTAACATGGCAGGAAGGG + Intergenic
1091326936 11:134698176-134698198 TTAATGTAACACTGCATGAAAGG - Intergenic
1096150381 12:49306490-49306512 TTCTGCTAACAGTCTATGTAAGG + Intergenic
1096705761 12:53420989-53421011 TTCTGGGAAACCTGCATGAAAGG - Intergenic
1104459561 12:128944387-128944409 TTCTGGTAATAGTCCAGGACTGG + Intronic
1108671629 13:52696003-52696025 TTTTGGTATGACTCCATCAAAGG - Intronic
1110374170 13:74773749-74773771 TTATGGTAACATTCCATGCCTGG + Intergenic
1111937854 13:94575235-94575257 ATATGGTAACACTGCATGAGAGG + Intronic
1114270053 14:21095136-21095158 ATGTGGTAAAACTCCATGAAGGG + Intronic
1116381704 14:44277060-44277082 TTCTGCTCACACTCAAGGAAAGG + Intergenic
1117031874 14:51680309-51680331 TTCAGGAAAGATTCCATGAAGGG - Intronic
1202903009 14_GL000194v1_random:53965-53987 TCCTGGGAAGACGCCATGAAAGG + Intergenic
1131620661 15:94064952-94064974 TTCTTGTAATACTTTATGAAAGG - Intergenic
1146807148 17:35873759-35873781 TTCTAGTAACAACACATGAATGG - Intronic
1146820948 17:35983306-35983328 TTTAGGTAACACTTCATAAAGGG - Intronic
1154232049 18:12565725-12565747 TTCTGTTAACATTCCTTGCAAGG - Intronic
1156007327 18:32458279-32458301 TTTGGGGAACTCTCCATGAATGG + Intronic
1160671800 19:368577-368599 GTCAGGTAACGCTCCAAGAATGG - Intronic
1164935775 19:32210077-32210099 TTGTGGTCCCACTCCATTAAAGG + Intergenic
925825976 2:7849004-7849026 CTCTACTAACACTCCATGATGGG - Intergenic
930311154 2:49740991-49741013 TTGTGTAAACACTTCATGAACGG - Intergenic
931358163 2:61555077-61555099 TTCAGATAACACTCCAAGCAGGG + Intergenic
936641811 2:114321320-114321342 TTCTGGTTACAATGCATGAGGGG - Intergenic
938729561 2:134135894-134135916 TTCTGGAAAAACTGCAGGAATGG + Intronic
941788673 2:169526496-169526518 TTTTGGCTACACTCCATGAAAGG + Intergenic
942452950 2:176120007-176120029 TTCTGGTTACACTCCCTGTTTGG + Intergenic
946843502 2:223839425-223839447 TTCTGGAAACACTTCAAAAAAGG + Intergenic
947781122 2:232764415-232764437 TTCTGGGACCACCCCTTGAAAGG + Intronic
947949851 2:234137755-234137777 TTCTGGTAAAACCCCCTCAAAGG + Intergenic
1176277551 20:64281013-64281035 TTCTGGATATTCTCCATGAATGG + Intronic
1176622372 21:9068732-9068754 TCCTGGGAAGACGCCATGAAAGG + Intergenic
955530507 3:59868067-59868089 TTCTGGCAAAACACAATGAAAGG - Intronic
957400046 3:79699778-79699800 TTCTGGGAACATTTCTTGAAAGG + Intronic
957797988 3:85036825-85036847 TTCTGGTAAAACTACATTATGGG + Intronic
958110611 3:89138770-89138792 TTTTGTTAAGACTCCAGGAAGGG + Intronic
959136631 3:102430910-102430932 TTATGATTACACTTCATGAAAGG + Intronic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
962494143 3:135922606-135922628 TTCAGGTTACACTCCTTGGAGGG + Intergenic
965341192 3:167493302-167493324 ATCTGATACCACTCCATGAACGG + Intronic
965584296 3:170302256-170302278 TTCTGCAAACACTTAATGAATGG - Intronic
967446824 3:189577095-189577117 TTCTAGAAACTTTCCATGAATGG - Intergenic
968188101 3:196647053-196647075 TTATGGTAAAACTACATGATAGG - Intronic
968205353 3:196794797-196794819 TTCTGGTAGCAGTACAGGAAGGG - Intronic
973099332 4:46243950-46243972 TACTGGAAACATTTCATGAAAGG + Intergenic
974316661 4:60290813-60290835 ATATGGTAACACTCCGAGAATGG + Intergenic
975062915 4:70025545-70025567 TTATGGATACAATCCATGAATGG - Intergenic
975064837 4:70047803-70047825 TTATGGATACAATCCATGAATGG - Intergenic
976864950 4:89713701-89713723 TTATGGTAACAGTCCCTAAAAGG - Intergenic
978645733 4:110929216-110929238 TGCATCTAACACTCCATGAAGGG + Intergenic
980711247 4:136571362-136571384 TTCTCATATCACTCCATGAATGG + Intergenic
983235155 4:165170947-165170969 TCCAGCTAACACTCAATGAAAGG + Intronic
984457663 4:179991356-179991378 TTCTGGTAACACTGAAACAAAGG - Intergenic
984468599 4:180134487-180134509 TTCTGGTAACGGTCTGTGAAAGG - Intergenic
988290842 5:29283730-29283752 TTTTGGTAACAATCCTTGATTGG + Intergenic
990763997 5:59162096-59162118 TTTTGGTATCACTGGATGAAAGG - Intronic
991649809 5:68840334-68840356 TTCTGGTCACACTACATTATGGG - Intergenic
992160421 5:73995437-73995459 TTCTGGTAAGAATACATTAAAGG - Intergenic
996519899 5:124414863-124414885 TTATGGTTACACTTCATGACAGG + Intergenic
996834236 5:127773197-127773219 TTCTGGTAACATTCAATGAGTGG + Intergenic
997665652 5:135627816-135627838 TTCAGGTCCCACTCCATGACAGG - Intergenic
998226761 5:140333142-140333164 TTCTGGTGCTACTCCATGCAGGG - Exonic
1001511049 5:172322203-172322225 CTCTGGACACACTCCATGCATGG + Intergenic
1001702113 5:173714231-173714253 TTCAGGTAATGCTCCAGGAAAGG + Intergenic
1003007114 6:2392399-2392421 TTCTGGGGACACTTCATGGAAGG - Intergenic
1004341684 6:14813390-14813412 TTCTGGCAACACCCAATGATGGG + Intergenic
1009836746 6:69010912-69010934 TTCTTTTAAAACTCCATTAATGG - Intronic
1011412447 6:87079963-87079985 TTCTGCTAACATCCCATTAACGG + Intergenic
1016391999 6:143584236-143584258 TTCTGGTCCCAGTCCATGACGGG - Intronic
1020702364 7:11499196-11499218 GTCTGGTGACAAGCCATGAAGGG - Intronic
1022029817 7:26481848-26481870 TTCGGGTAACACCCACTGAAAGG + Intergenic
1023961087 7:44926944-44926966 TTGTGGTATCACTCCATGGCAGG - Intergenic
1028949729 7:96620727-96620749 TTCTGGTTCCTCTCCATGGAGGG + Intronic
1037251640 8:16902285-16902307 TTCTGGTAGATCTCTATGAAAGG - Intergenic
1037493048 8:19413468-19413490 TTCTGGAAAGGCTCCATAAAGGG + Intronic
1041566320 8:59283013-59283035 TTTTCATCACACTCCATGAAAGG - Intergenic
1044052106 8:87517902-87517924 TTCTGGTTATAGTCCTTGAAAGG - Intronic
1048029303 8:130615867-130615889 TTCAGGAAACATCCCATGAAAGG + Intergenic
1054773839 9:69108036-69108058 TTCTGGTAATATTCCAGGACTGG + Intergenic
1056876256 9:90334375-90334397 TTCTGTCAACACTTCTTGAAGGG - Intergenic
1056971853 9:91211299-91211321 TTCTGGTAACACAACATAAGAGG - Intergenic
1057721280 9:97534075-97534097 TTCTGGTAACTTTCCTTAAAAGG - Intronic
1057882489 9:98802997-98803019 TTCTGGTACCACACCATGCTCGG + Intergenic
1057897374 9:98920020-98920042 TTCAGGAAACAGTCTATGAATGG + Intergenic
1203745569 Un_GL000218v1:39161-39183 TCCTGGGAAGACGCCATGAAAGG + Intergenic
1203564539 Un_KI270744v1:80322-80344 TCCTGGGAAGACGCCATGAAAGG - Intergenic
1195436615 X:104851923-104851945 TTCTCTTAATACTCCAAGAATGG + Intronic
1196660851 X:118267181-118267203 TTCTGATAACAGTGCAAGAATGG + Intergenic
1199149731 X:144416232-144416254 TTCTCATAATACTCCATGCAAGG + Intergenic
1200909921 Y:8522905-8522927 TTCTTGAAAGAATCCATGAATGG + Intergenic
1201158893 Y:11154173-11154195 TCCTGGGAAGACGCCATGAAAGG + Intergenic