ID: 916676175

View in Genome Browser
Species Human (GRCh38)
Location 1:167065944-167065966
Sequence GGTCCCCGGGGAACAAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916676170_916676175 -6 Left 916676170 1:167065927-167065949 CCAGCAGCCAACAAGCAGGTCCC 0: 1
1: 0
2: 1
3: 17
4: 158
Right 916676175 1:167065944-167065966 GGTCCCCGGGGAACAAGAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 158
916676168_916676175 3 Left 916676168 1:167065918-167065940 CCACTCTTACCAGCAGCCAACAA 0: 1
1: 0
2: 1
3: 10
4: 187
Right 916676175 1:167065944-167065966 GGTCCCCGGGGAACAAGAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916676175 Original CRISPR GGTCCCCGGGGAACAAGAGA AGG Intronic
900179554 1:1305227-1305249 AGCCCCTTGGGAACAAGAGAGGG - Intronic
900322123 1:2090025-2090047 GGGCCCGGGTGAAGAAGAGACGG - Intronic
900396601 1:2455612-2455634 GGACCCCAGGGAACAAGCGTCGG - Intronic
900539677 1:3196565-3196587 GGTGCCCGTGGCACCAGAGAGGG + Intronic
900581845 1:3413314-3413336 GGCCCCGGGGGAATCAGAGAAGG + Intronic
901067018 1:6498993-6499015 GGTCCCCGTGGAAACACAGATGG - Intronic
904529554 1:31159292-31159314 GATCCCAGGGGCTCAAGAGAAGG + Intergenic
907976283 1:59434491-59434513 GGGCCCAAGGGAACTAGAGAGGG + Intronic
911242313 1:95479659-95479681 GGGTACTGGGGAACAAGAGATGG - Intergenic
912514032 1:110207030-110207052 GCTCATGGGGGAACAAGAGAAGG - Intergenic
913276711 1:117145391-117145413 GGTTGCTGGGGAAAAAGAGATGG + Intronic
915507921 1:156369095-156369117 GGGCCCCGGGGACCAGGAGCGGG - Intergenic
916676175 1:167065944-167065966 GGTCCCCGGGGAACAAGAGAAGG + Intronic
918647475 1:186920149-186920171 AGTCCCCTGGGAAGAAGAAAGGG - Intronic
920367309 1:205455053-205455075 TGCCCCCGGGGAACAAGAGCTGG - Intronic
1064430075 10:15263038-15263060 GCTGCCCGGGGAACAGGAAAAGG + Intronic
1065129933 10:22610270-22610292 GGTCCCAGGACTACAAGAGAAGG + Intronic
1067778093 10:49177304-49177326 GCTGCCCTGGGAACTAGAGAGGG - Intronic
1071186063 10:83046953-83046975 GGTACCCGAGGGAGAAGAGAAGG - Intergenic
1080850385 11:36063417-36063439 GGTTCCCAGGGACTAAGAGAGGG - Intronic
1081644188 11:44778366-44778388 TGTCTGCGGGGAAAAAGAGAGGG - Intronic
1083625557 11:64070304-64070326 GGCCCCCAGGGAACATGAGGAGG - Intronic
1085861462 11:80240997-80241019 GGGCTTTGGGGAACAAGAGAGGG - Intergenic
1088644642 11:111908001-111908023 GGCCCCGGGGGAGCAGGAGATGG - Intergenic
1088707343 11:112475747-112475769 GGCTCCCAGGGAACATGAGAGGG - Intergenic
1089711376 11:120317241-120317263 GTTCCCCTGGGAACAACAGCAGG + Exonic
1093698311 12:22188735-22188757 GGGCCAGGGGGAAGAAGAGAGGG + Intronic
1095940910 12:47726180-47726202 GCTCCCAGGGGAAGAAGAGTGGG - Intergenic
1099416077 12:82388360-82388382 GTTCCCCCTGGAGCAAGAGAGGG + Intronic
1099871249 12:88351977-88351999 GGTGGCGGGGGAACAAAAGAAGG + Intergenic
1104686299 12:130787305-130787327 GGTCCCATGGGACCAAGACATGG - Intergenic
1106113555 13:26797805-26797827 GGGCCCCAGGGTAGAAGAGAGGG + Intergenic
1108498720 13:51049436-51049458 GGTCACCGGTTGACAAGAGAAGG + Intergenic
1108853075 13:54759410-54759432 TGTCCACGGAGAATAAGAGAAGG + Intergenic
1110014743 13:70386710-70386732 GGTTCCTGGGGAGGAAGAGATGG - Intergenic
1113168906 13:107475896-107475918 GGTCCATGGGGAAAAAAAGAGGG - Intronic
1113460547 13:110479322-110479344 GGTCCCCGGTGACCCAGAGGAGG + Intronic
1115443954 14:33467848-33467870 TTTCCCCAGAGAACAAGAGATGG + Intronic
1115788196 14:36849953-36849975 AGTCCCTGGGGATCAAGTGAAGG + Intronic
1116048251 14:39771185-39771207 GCTTCCAGGGGAACAAGAGATGG - Intergenic
1117547367 14:56804502-56804524 GGTCCCCGGGGAGCAAGGCTGGG - Intronic
1119544246 14:75460270-75460292 GGACCCTGGGGAACAAGCAAGGG - Intronic
1121117337 14:91352962-91352984 GGGCCCCGGGGAACTTGTGAGGG - Intronic
1121413303 14:93762472-93762494 TGTCCCAGGGGAACAGGACAGGG - Intronic
1122088443 14:99322649-99322671 GTTCCCTGGGGGAGAAGAGAGGG + Intergenic
1122098620 14:99389458-99389480 GCTCCCCGGGGATAAAGGGAGGG + Intergenic
1122285727 14:100651225-100651247 TGTCCCCGGGAAGAAAGAGATGG - Intergenic
1124686908 15:31790714-31790736 GGTCTTCAGGGCACAAGAGATGG - Intronic
1124890430 15:33727079-33727101 GGACCCAGGGGAAAACGAGAAGG - Intronic
1124968176 15:34455517-34455539 TCTCCCCTTGGAACAAGAGACGG - Intergenic
1125347746 15:38735796-38735818 GGTCTTAGGGGAACAAGACATGG + Intergenic
1127450488 15:59111760-59111782 GGTACCCAGGGTACCAGAGACGG - Intronic
1128080641 15:64855021-64855043 GATCCCCAGGGAACAAGGTAGGG + Exonic
1131097557 15:89666021-89666043 GCTCCCGGGGGAACAATCGAGGG - Intronic
1131509796 15:93043742-93043764 GGTCCCTGGGGAACAGCAGAGGG + Intronic
1132367793 15:101270116-101270138 GGCCCCTGGGGAAGAAGGGACGG - Intergenic
1132625648 16:890286-890308 GGCCCCCGGGAAGCAAGAAAAGG + Intronic
1132934802 16:2474924-2474946 GGTCCCGGGGGGACAAGCCAAGG - Intergenic
1134098506 16:11435546-11435568 GGTCTCAGGGGAACAGAAGAGGG + Intronic
1136582219 16:31159921-31159943 GGTCCCTGGAGACCAAGAGGTGG - Intergenic
1138527980 16:57619931-57619953 GGACACCTGGGAACAAGAGAGGG + Intronic
1140194812 16:72847451-72847473 GCTCCCAGGGTACCAAGAGATGG - Intronic
1141135674 16:81463692-81463714 TGTCCCCGTGTTACAAGAGAGGG + Intronic
1141798089 16:86287924-86287946 CCTCCCTGGGGAGCAAGAGAAGG + Intergenic
1143730871 17:8881998-8882020 GGGCCCTGGTGAATAAGAGAGGG - Intronic
1146843797 17:36171433-36171455 GGTCCGCTGGGAACATGACATGG - Intronic
1146856104 17:36259367-36259389 GGTCCGCTGGGAACATGACATGG - Intronic
1146864517 17:36329008-36329030 GGTCCGCTGGGAACATGACATGG + Intronic
1146872009 17:36383278-36383300 GGTCCGCTGGGAACATGACATGG - Intronic
1146879371 17:36434363-36434385 GGTCCGCTGGGAACATGACATGG - Intronic
1147067375 17:37929596-37929618 GGTCCGCTGGGAACATGACATGG + Intronic
1147074897 17:37983902-37983924 GGTCCGCTGGGAACATGACATGG - Intronic
1147078906 17:38009157-38009179 GGTCCGCTGGGAACATGACATGG + Intronic
1147086420 17:38063448-38063470 GGTCCGCTGGGAACATGACATGG - Intronic
1147094843 17:38133092-38133114 GGTCCGCTGGGAACATGACATGG + Intergenic
1147102365 17:38187411-38187433 GGTCCGCTGGGAACATGACATGG - Intergenic
1147613361 17:41813920-41813942 GGTTCCAGGAGAACCAGAGAGGG - Intronic
1148205768 17:45778957-45778979 GGTCGGCTGGGAACAGGAGATGG - Intergenic
1148407028 17:47424259-47424281 GGACGCCGGGGAAGAGGAGAAGG + Intronic
1150587338 17:66530921-66530943 GGCCCCCAGGGTATAAGAGAAGG - Intronic
1151344619 17:73494069-73494091 GGGCCCCTGGGAACAGGAGAGGG - Intronic
1151398106 17:73838466-73838488 GGTCCCAGGGGAGCCAGTGAGGG - Intergenic
1151814099 17:76462650-76462672 GCTCCCCGGGGGATGAGAGATGG - Intronic
1152858210 17:82678698-82678720 GGTCCCCGGGGCAGAGGGGAGGG + Intronic
1152928171 17:83097411-83097433 GTCCCCCGAGGAAAAAGAGAGGG + Intergenic
1157472780 18:48002909-48002931 GGCCCTAGGGAAACAAGAGAGGG - Intergenic
1158725746 18:59969813-59969835 GGACGCCGGGGAAGAGGAGAAGG + Intergenic
1161585209 19:5102067-5102089 GGTCCCCTGGAAACAAGGGTGGG - Intronic
1163263625 19:16205649-16205671 GGTCCCCGGGCCGCCAGAGAAGG - Intronic
1163348920 19:16763103-16763125 GGTCTCGGGGGGAGAAGAGAAGG - Intronic
1166931919 19:46306218-46306240 GGGCCCCGGGGAGCTATAGAAGG + Intronic
1168317821 19:55491678-55491700 GGTCCAAGGGGTACAGGAGAGGG - Intronic
929788563 2:45008498-45008520 GCTCCCCGGGGCCCAAGGGAGGG - Intronic
931356003 2:61538077-61538099 AGTCGCTGAGGAACAAGAGAAGG - Exonic
931949043 2:67340787-67340809 GGGCCCCTGGCAAAAAGAGAAGG - Intergenic
935599156 2:104904811-104904833 GGTACCTGGGGTGCAAGAGAGGG + Intergenic
937123284 2:119455567-119455589 AGTGCCCGGAGAACAAGAAAGGG + Intronic
937758365 2:125568658-125568680 AGGGCCCGGGGAAGAAGAGATGG + Intergenic
938610729 2:132945122-132945144 GGTCCTCAGGGGACAGGAGAAGG + Intronic
947391779 2:229646755-229646777 GGTCCACGGTGAACCAGACAAGG + Intronic
947734442 2:232447365-232447387 GGTCCCCGAGGAAGAGGAGGAGG + Intergenic
1171371467 20:24665081-24665103 GGCCCCAAGGGAATAAGAGAAGG - Intronic
1172786034 20:37469509-37469531 GGTCCCAGGAGAACAGGAGAAGG - Intergenic
1172786046 20:37469563-37469585 GGTCCTAGGGGAGCAGGAGAAGG - Intergenic
1172874900 20:38158268-38158290 GATCCTGGGGGAACAGGAGAAGG + Intronic
1173729121 20:45316608-45316630 GGGCCCCGGGGAGCAGGGGAAGG + Intronic
1177338115 21:19760024-19760046 GGTCCCCGGGGTCCCAGAGATGG - Intergenic
1181941707 22:26483233-26483255 AGTCCTCTGGGAACAAGGGATGG - Intronic
1182284134 22:29234119-29234141 GGTCCCTGAGCAACAAGACAGGG - Exonic
1183461377 22:37953063-37953085 GGTCCCCGGGGTGTAAGTGATGG + Exonic
1185139254 22:49091239-49091261 GTGCCCCAGGAAACAAGAGAAGG + Intergenic
950981368 3:17309777-17309799 AGTACCAGGGGAACCAGAGATGG + Intronic
951691860 3:25405123-25405145 GGTCTCTGGGGATTAAGAGACGG - Intronic
956024440 3:64967629-64967651 TTGCCCCAGGGAACAAGAGATGG + Intergenic
956178784 3:66499629-66499651 GGTCTTCGGGGATCAGGAGACGG + Intronic
956854377 3:73261553-73261575 CATCCCTGGGGAAGAAGAGAGGG + Intergenic
961040067 3:123671914-123671936 GCTCTCCAGGGAAGAAGAGAGGG + Intronic
962710023 3:138078377-138078399 GGTCCTTGGGGGACGAGAGATGG - Intronic
962927090 3:140004933-140004955 GGTCCCAGTGGACCAATAGAAGG - Intronic
964810024 3:160653554-160653576 GGTCCCTGGGGGACAGCAGAGGG + Intergenic
965060498 3:163779442-163779464 GGTCACCAGGGAACAGGAAATGG + Intergenic
967771963 3:193344014-193344036 TGTCTCCGGGAACCAAGAGACGG + Exonic
967894107 3:194383105-194383127 GGGCCCCGGGGAAGCAGAGAAGG + Intergenic
968626699 4:1629152-1629174 GGTCCCTGGGGCACTAGAGTGGG + Intronic
969232738 4:5842942-5842964 GGTTCCCGGGGAAAACAAGATGG + Intronic
971387848 4:26157780-26157802 GGTCTCAGGGAAGCAAGAGAGGG - Intergenic
972726850 4:41752025-41752047 GGACCCCGGGCCACAAAAGACGG - Intergenic
978721717 4:111917781-111917803 GGTCCGTGGGGAAGATGAGAAGG + Intergenic
981630864 4:146816700-146816722 GAGCCCAGGGGAGCAAGAGAGGG + Intronic
983551043 4:169017865-169017887 GGACCCCGTGGAACTAGAGATGG + Intergenic
985832183 5:2242022-2242044 GGTCCCCGGGGAGCCAGGGCAGG - Intergenic
987304506 5:16624976-16624998 GGTCCCCTGGGGAGAGGAGAGGG - Intergenic
988087116 5:26486376-26486398 GGTCACTGGGGAAAAAAAGAGGG + Intergenic
996713659 5:126568477-126568499 TGTCCCAGGGGAGCAAGGGAAGG + Intronic
1000082231 5:157859000-157859022 GGTCCGTGGGGAGCAGGAGAGGG - Exonic
1007412671 6:41673972-41673994 GGCCCCCAGGGAACAGGAGCAGG + Intergenic
1013772189 6:113640428-113640450 GGACCAGTGGGAACAAGAGAAGG + Intergenic
1014736521 6:125100702-125100724 AGTCCCTGGTTAACAAGAGAAGG - Intergenic
1017821627 6:158053482-158053504 GGTGAATGGGGAACAAGAGAGGG - Intronic
1019428528 7:988225-988247 GGGCCCCGGGGAAGATGGGATGG - Intronic
1021992752 7:26152993-26153015 GGACGCCGGGGAAGAGGAGAAGG + Exonic
1024167678 7:46750786-46750808 GGGCCCTGTGGAACAAGAGGAGG + Intronic
1024311265 7:47971408-47971430 AGTCCCCGGGCAGCAAGAGCAGG - Intronic
1025078471 7:55963323-55963345 AGTCCCAGGGGAAGAAGGGAGGG - Intronic
1029446441 7:100615446-100615468 GGTCCCCTGGGAACAGGGGTGGG - Intergenic
1029599050 7:101553248-101553270 GGCCCCCAGGGAACTGGAGAGGG + Intronic
1030084900 7:105807650-105807672 GTTCCAAGGAGAACAAGAGAGGG - Intronic
1032550379 7:132779021-132779043 CTTCTCCGGGGAACCAGAGAAGG + Intergenic
1034801066 7:154057058-154057080 GGGCCACTGGGATCAAGAGAGGG - Intronic
1038427559 8:27474090-27474112 AGTCCCCGGGGAACTGCAGAGGG + Intronic
1041780261 8:61570539-61570561 GGGCCCTGGGGCACCAGAGAGGG - Intronic
1043874396 8:85467994-85468016 GGGCTCCGGGGAACAGGAGAGGG - Intronic
1048477697 8:134757838-134757860 GGTCCCGAGGGGACCAGAGAGGG + Intergenic
1048870593 8:138793902-138793924 GGTCCCAGAGGAACATGGGAAGG + Intronic
1049336627 8:142090039-142090061 GGTCCCCGGGGATGGAGGGAGGG + Intergenic
1049350054 8:142159630-142159652 GGTGCCTGGGCAACAACAGATGG - Intergenic
1049382837 8:142325921-142325943 GGGCCCCGGAGAGCACGAGACGG + Intronic
1049382895 8:142326165-142326187 GGGCCCCGGAGAGCACGAGACGG + Intronic
1049382920 8:142326265-142326287 GGGCCCCGGAGACCACGAGACGG + Intronic
1049382956 8:142326415-142326437 GGGCCCCGGAGACCATGAGACGG + Intronic
1049383008 8:142326616-142326638 GGGCCCCGGAGAGCATGAGACGG + Intronic
1051362024 9:16289534-16289556 AGTACCTGGGGGACAAGAGAGGG + Intergenic
1051533333 9:18129854-18129876 TTTCCCTGGGGAACAAGGGAAGG - Intergenic
1056090974 9:83205595-83205617 AGTGCCTGGGGAGCAAGAGAGGG - Intergenic
1060402007 9:123354806-123354828 GGTCCCCAGGGACCAAAGGAGGG - Intergenic
1192448037 X:71224831-71224853 GGACCACTGGGTACAAGAGATGG + Exonic
1192798724 X:74446127-74446149 GGTCCCAGGGGAAGAGGAGGGGG - Intronic
1196031542 X:111098794-111098816 GGTCCCCAGGGATCCTGAGAAGG - Intronic
1199264982 X:145818582-145818604 GGAGTCCGGGGAACCAGAGAGGG - Exonic