ID: 916677323

View in Genome Browser
Species Human (GRCh38)
Location 1:167074983-167075005
Sequence CACTTGAACCTGGCGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68307
Summary {0: 3, 1: 11, 2: 614, 3: 15176, 4: 52503}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916677323_916677333 17 Left 916677323 1:167074983-167075005 CCTCCTCCCGCCAGGTTCAAGTG 0: 3
1: 11
2: 614
3: 15176
4: 52503
Right 916677333 1:167075023-167075045 TCCCGAGTAGCTGGGATTACAGG 0: 44204
1: 206428
2: 253404
3: 185491
4: 423321
916677323_916677331 9 Left 916677323 1:167074983-167075005 CCTCCTCCCGCCAGGTTCAAGTG 0: 3
1: 11
2: 614
3: 15176
4: 52503
Right 916677331 1:167075015-167075037 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
916677323_916677329 8 Left 916677323 1:167074983-167075005 CCTCCTCCCGCCAGGTTCAAGTG 0: 3
1: 11
2: 614
3: 15176
4: 52503
Right 916677329 1:167075014-167075036 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916677323 Original CRISPR CACTTGAACCTGGCGGGAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr