ID: 916679967

View in Genome Browser
Species Human (GRCh38)
Location 1:167094908-167094930
Sequence GGCCTGCACCGCCCTCACGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916679967 Original CRISPR GGCCTGCACCGCCCTCACGT TGG (reversed) Exonic
900635718 1:3664107-3664129 GGGCTGCACCAGCCTCACTTGGG - Intronic
903813327 1:26046635-26046657 GGGCTGCGCCGCCCTCAGGCTGG + Intergenic
904876226 1:33656574-33656596 GGCCTGCACCTCTCTCACTCAGG - Intronic
907306304 1:53514926-53514948 GGCCAGCACCTCCCTCACTGGGG - Intronic
914054764 1:144160121-144160143 GGCCTTCCCCGCCCTCACCACGG + Intergenic
914124382 1:144806240-144806262 GGCCTTCCCCGCCCTCACCACGG - Intergenic
916679967 1:167094908-167094930 GGCCTGCACCGCCCTCACGTTGG - Exonic
918015828 1:180631955-180631977 CGCCTACACCGCCCTGACGAAGG - Intergenic
919805734 1:201380072-201380094 TGCCTGCACCCCCCTCCCCTGGG - Intronic
920680804 1:208071075-208071097 GGCCTGCACAGCTCTCACCATGG + Intronic
922801388 1:228366243-228366265 GGACTGCACCCACCTCCCGTGGG - Intronic
923915031 1:238492319-238492341 GGCCTCCACCTCCCTCAGGCTGG - Intergenic
1066733024 10:38450746-38450768 AGCCTGCTCCTCCCTCACGGTGG - Intergenic
1073425302 10:103452216-103452238 GCCCTGCACCGCCCTCCTGGAGG - Exonic
1075144526 10:119872375-119872397 GGCCTGCACCGGCCCCAGCTGGG - Intronic
1076096791 10:127739040-127739062 GGCCTTCAACGCCAACACGTGGG - Exonic
1076612636 10:131736401-131736423 GGCCTGCCCCGCCCTAAGGTGGG + Intergenic
1079106040 11:17573094-17573116 GGCCTGCAGCGTGCTCACGGGGG + Exonic
1080596001 11:33774609-33774631 GGCCAGCCCCGCCCTCAGGGTGG + Intergenic
1081814646 11:45931756-45931778 AGCCTCCACCGCCCTCCCATCGG + Intronic
1083876042 11:65525004-65525026 GTCCTGCTCCGCCCCGACGTAGG + Intergenic
1087711918 11:101563798-101563820 GGCCTGTACTGCCCTCACCTTGG - Intronic
1089670675 11:120054811-120054833 GGCCTGCAAAGCCCTCCCGGGGG + Intergenic
1092524187 12:9299464-9299486 GCCCTGCAGGGCCCTCACCTTGG - Intergenic
1092543080 12:9432348-9432370 GCCCTGCAGGGCCCTCACCTGGG + Intergenic
1094509939 12:31090090-31090112 GCCCTGCAGGGCCCTCACCTGGG - Exonic
1102002551 12:109566438-109566460 AGCCTGCACAGCCCTCCCTTTGG - Intronic
1103924347 12:124415277-124415299 GGCCTGCTGTGCCCTCACCTGGG + Intronic
1112365643 13:98752826-98752848 GGCCTGCCACGCGCTCCCGTCGG - Intergenic
1113675416 13:112203374-112203396 TGCCTGCTACGTCCTCACGTTGG - Intergenic
1113770118 13:112902854-112902876 GGCCTGCCCAGCTCTCACCTCGG - Intronic
1125760495 15:42093006-42093028 GCCCTGCACCTCCCTCAGGCTGG + Intronic
1129450299 15:75647746-75647768 GGCCAGCTCCGCCCTCCCGCGGG - Intronic
1132117790 15:99150140-99150162 GGCCTGCAAGGCCTGCACGTAGG + Intronic
1132590966 16:726317-726339 GGCCTGGACCTCCCTCTCGGCGG - Exonic
1132805286 16:1772412-1772434 GGCCTTCACCGCGTTCACGCCGG - Exonic
1133040583 16:3058268-3058290 GGCCTGCACCACCCTCACCTGGG - Exonic
1139343532 16:66287590-66287612 GGCCTCCACTTCCCACACGTGGG - Intergenic
1142690201 17:1601555-1601577 GGCATGCACCGCCCTCCCAAAGG + Intronic
1142690214 17:1601633-1601655 GGCATGCACCGCCCTCCCGAAGG + Intronic
1143338347 17:6190324-6190346 GGCCTGGACTGCCCTGAGGTGGG + Intergenic
1147975855 17:44247785-44247807 GCCCTGCACTGACCTCTCGTTGG + Intergenic
1148885168 17:50767181-50767203 GGCCTGCACCGTCTTCCAGTGGG - Intergenic
1150226750 17:63528573-63528595 GGCCTGCGTCCCCCACACGTGGG + Intronic
1152646151 17:81469403-81469425 GGCCTGCCCCTGCCTCAGGTGGG + Intergenic
1153997261 18:10453986-10454008 GACCTGCACCGCACCCACGAGGG + Intergenic
1155909112 18:31488049-31488071 GGCCTCCTCCACCCCCACGTTGG + Intergenic
1158361963 18:56684617-56684639 GGCCTGCACCACTCTCAGCTGGG - Intronic
1160404338 18:78634858-78634880 GGCCTGCACAGCCCTGACGGGGG - Intergenic
1160441677 18:78898227-78898249 GGCCTGCACCACCCCCATGATGG - Intergenic
1160441729 18:78898484-78898506 GGCCTGTACCACCCCCACGATGG - Intergenic
1160441755 18:78898608-78898630 GGCCTCCACCACCCCCACGATGG - Intergenic
1160441768 18:78898668-78898690 GGCCTACACCACCCCCACGATGG - Intergenic
1160441805 18:78898867-78898889 GGCCTGCACCACTCCCACGATGG - Intergenic
1160441816 18:78898927-78898949 GGCCTGCACCACCCCCACGATGG - Intergenic
1163085918 19:14979709-14979731 GGCCGGCCCTGCGCTCACGTGGG + Intronic
938087013 2:128408406-128408428 GGCCTGCATGGGCCCCACGTGGG + Intergenic
938288995 2:130139754-130139776 GGCCTGCATGGCCCTCACGGGGG + Intronic
938337394 2:130511784-130511806 AGCCTCCACCGCCCTGACCTAGG + Intergenic
938352444 2:130608951-130608973 AGCCTCCACCGCCCTGACCTAGG - Intergenic
938467535 2:131533184-131533206 GGCCTGCATGGCCCTCACGGGGG - Intronic
938760514 2:134421617-134421639 GGCCTGCAGGGCTTTCACGTGGG - Intronic
948012433 2:234660368-234660390 GCCCAGCACAGCCCTCACCTGGG + Intergenic
948781247 2:240323178-240323200 GGCCTCCACTGCCCTCCGGTAGG - Intergenic
1168915002 20:1478399-1478421 GGCCTGCACCGCTGTCTCCTTGG + Exonic
1168964560 20:1891519-1891541 AGCCTCCACCGCTCTCACCTGGG - Intergenic
1169211136 20:3766970-3766992 GGGCTGCACCTCCCTCCCGGTGG - Intronic
1175915807 20:62425222-62425244 GACCTGCGCCTCCCTCATGTGGG + Intronic
1183484796 22:38082982-38083004 GACCTGAGCCACCCTCACGTGGG - Intronic
1183586555 22:38756121-38756143 GGCTCGCCCCGCCCTCGCGTGGG + Intronic
1183604261 22:38859585-38859607 GGCCTGCACTTGCCTCACATGGG + Intergenic
1185330190 22:50248938-50248960 GGCCTGGCTCGCCCTCACCTGGG - Intronic
1185338607 22:50281836-50281858 GGGCTGCACCGTCCTCACCCGGG + Exonic
950022483 3:9797675-9797697 GGCCCGCACGGCACTCAGGTAGG - Exonic
958458495 3:94364217-94364239 GGCCTGCACTGCCCAAAAGTGGG + Intergenic
961473645 3:127134050-127134072 GGCCTGCACAGCTTTCACCTGGG + Intergenic
961825311 3:129596268-129596290 GGGCTACACCGCCCTCACCAAGG + Intronic
962367341 3:134795265-134795287 GGCCGGCTCCGTCCTCCCGTAGG + Exonic
968726549 4:2250543-2250565 GGGCCGCCCCGCCCTCTCGTAGG - Exonic
969619161 4:8270261-8270283 CGCCTGCAGCGCGCACACGTTGG - Exonic
987258435 5:16180004-16180026 GGCCGGCCCCGCGCTCACGTCGG + Intronic
1002309163 5:178304159-178304181 GGCCTGCAGCGGCCTCAGGGAGG + Intronic
1006122708 6:31816865-31816887 CGCCTGCACCGCCGCCCCGTAGG - Exonic
1006124571 6:31829059-31829081 CGCCTGCACCGCCGCCCCGTAGG - Exonic
1013392980 6:109705333-109705355 TGCCTGCACTGCCCTCTGGTGGG - Intronic
1015654061 6:135497510-135497532 GGCCTGCCCGGCCCTCTCCTGGG - Intronic
1018914867 6:168127031-168127053 GGCCTGCACCGCCCACCCCCAGG + Intergenic
1019382625 7:732366-732388 GCCCTGTGCCGCCCTCAGGTGGG + Intronic
1023401088 7:39793316-39793338 GCCCTGCTCCTCCCTCACGGTGG - Intergenic
1024075071 7:45813976-45813998 GCCCTGCTCCTCCCTCACGGTGG - Intergenic
1024648523 7:51387365-51387387 GCCCTGCTCCTCCCTCACGGTGG + Intergenic
1025052765 7:55743381-55743403 GTCCTGCTCCTCCCTCACGGTGG + Intergenic
1025129333 7:56367516-56367538 GCCCTGCTCCTCCCTCACGGGGG + Intergenic
1025130353 7:56371617-56371639 GCCCTGCTCCTCCCTCACGGTGG + Intergenic
1025130673 7:56372915-56372937 GCCCTGCTCCTCCCTCACGGTGG + Intergenic
1025130989 7:56374208-56374230 GGCCTGCTCCTCCCTCACGGTGG + Intergenic
1033529683 7:142249143-142249165 GGACTGCACTGCCCTCAGGTCGG - Intergenic
1036609173 8:10334896-10334918 GGCCCGAACAGCCATCACGTGGG - Intronic
1038577434 8:28717201-28717223 GTCCTGCACCGCCTTCAGGGTGG - Exonic
1040581149 8:48699653-48699675 CACCTGCACCTCCCTCACCTGGG + Intergenic
1042784963 8:72536940-72536962 GGCAGGCACCGCCCACACCTCGG - Intergenic
1049255140 8:141609667-141609689 GGCCTCCAGCCCCCTCACGCTGG - Intergenic
1053139985 9:35676202-35676224 GGCCAGCTCCGCGCTCACCTCGG - Exonic
1059570030 9:115424680-115424702 GGCCTGCAGCACCTTCATGTTGG - Intergenic
1186711693 X:12204509-12204531 GGCATGCAGCGCCCGCACCTTGG - Intronic
1200127202 X:153821354-153821376 GTCCTGTAAAGCCCTCACGTAGG + Intronic
1201575278 Y:15455994-15456016 GCCCAGGACCGCCCTCACGGAGG + Intergenic