ID: 916680935

View in Genome Browser
Species Human (GRCh38)
Location 1:167104462-167104484
Sequence GATGCTTGCTCGCCACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916680935_916680942 2 Left 916680935 1:167104462-167104484 CCTTCCTGTGGCGAGCAAGCATC 0: 1
1: 0
2: 0
3: 6
4: 80
Right 916680942 1:167104487-167104509 TGGTGGGTGTGGTAGGAGACAGG 0: 1
1: 0
2: 4
3: 50
4: 532
916680935_916680941 -5 Left 916680935 1:167104462-167104484 CCTTCCTGTGGCGAGCAAGCATC 0: 1
1: 0
2: 0
3: 6
4: 80
Right 916680941 1:167104480-167104502 GCATCTGTGGTGGGTGTGGTAGG 0: 1
1: 0
2: 3
3: 52
4: 488
916680935_916680943 3 Left 916680935 1:167104462-167104484 CCTTCCTGTGGCGAGCAAGCATC 0: 1
1: 0
2: 0
3: 6
4: 80
Right 916680943 1:167104488-167104510 GGTGGGTGTGGTAGGAGACAGGG 0: 1
1: 1
2: 7
3: 66
4: 517
916680935_916680944 4 Left 916680935 1:167104462-167104484 CCTTCCTGTGGCGAGCAAGCATC 0: 1
1: 0
2: 0
3: 6
4: 80
Right 916680944 1:167104489-167104511 GTGGGTGTGGTAGGAGACAGGGG 0: 1
1: 0
2: 2
3: 55
4: 534
916680935_916680940 -9 Left 916680935 1:167104462-167104484 CCTTCCTGTGGCGAGCAAGCATC 0: 1
1: 0
2: 0
3: 6
4: 80
Right 916680940 1:167104476-167104498 GCAAGCATCTGTGGTGGGTGTGG 0: 1
1: 0
2: 3
3: 20
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916680935 Original CRISPR GATGCTTGCTCGCCACAGGA AGG (reversed) Intronic
916680935 1:167104462-167104484 GATGCTTGCTCGCCACAGGAAGG - Intronic
920679130 1:208059410-208059432 GATGCCTGCCAGCCACAGCAGGG - Intronic
922206779 1:223455074-223455096 AATGCTGGCTGGTCACAGGAAGG + Intergenic
924381634 1:243470761-243470783 GATGCTGTCTTGCCACAGGAGGG - Intronic
1063373661 10:5538690-5538712 GAAGCTTTCTTACCACAGGAAGG - Intergenic
1063627915 10:7707976-7707998 GCTGTTTTCTTGCCACAGGATGG - Intronic
1071097743 10:81998350-81998372 GTTGATTTCTAGCCACAGGAGGG - Intronic
1077404343 11:2376459-2376481 GGTGCTTTCTCCCCAGAGGAAGG - Intronic
1090374368 11:126278570-126278592 GAGGCTTGCTGGGAACAGGAAGG - Intergenic
1091273660 11:134335037-134335059 GATGCTGGCTGCCCACATGAAGG - Intronic
1092383379 12:8016798-8016820 TATTCTTGCTCTCCACAGAAAGG + Intergenic
1094094806 12:26691645-26691667 GATGCCTGCAGGCCCCAGGACGG - Intronic
1098749787 12:74279102-74279124 GACGTTTGCTGGCCAGAGGATGG + Intergenic
1102599290 12:114016967-114016989 GGTGCTTGCAGGCCACAGGTTGG + Intergenic
1104780972 12:131420377-131420399 GGTGCTTGCTTGGCACAGCATGG + Intergenic
1106682099 13:32018486-32018508 GATGCTTGCTGGGCCCAGGAAGG + Intergenic
1108624056 13:52210490-52210512 GAAGCTTCCTTGGCACAGGAGGG + Intergenic
1108662000 13:52595931-52595953 GAAGCTTCCTTGGCACAGGAGGG - Intergenic
1112468194 13:99663588-99663610 GATGCTTGGTCTCGACAGGCAGG - Intronic
1113853771 13:113432988-113433010 GAGGCCTGCCCTCCACAGGACGG + Intronic
1115190212 14:30739715-30739737 GCTCCTTGATAGCCACAGGACGG - Intergenic
1118767927 14:68922478-68922500 GAGGCTCCCTCCCCACAGGATGG + Intronic
1126614308 15:50561167-50561189 GATGCTTGTTGGCCACGGGAAGG - Exonic
1132859315 16:2062213-2062235 GAAGCTTGCTCCACACAGGTGGG - Intronic
1135268624 16:21049837-21049859 GATGCCTACTTCCCACAGGAGGG + Intronic
1135517092 16:23145201-23145223 GATGCCTGCTATACACAGGATGG + Intronic
1142866461 17:2794468-2794490 GCTGCTGGCTTCCCACAGGATGG - Intronic
1144639185 17:16928171-16928193 GCTGCCTGCCCGGCACAGGAGGG + Intergenic
1146329099 17:31912906-31912928 TATTCTAGCTTGCCACAGGAGGG - Intergenic
1148816035 17:50328997-50329019 GAGGCTTGCTGGGCACAGGGAGG - Intergenic
1152134294 17:78494859-78494881 CCTGCCTGCTGGCCACAGGAAGG - Intronic
1153314259 18:3706467-3706489 GATGCTTGCTCTTTGCAGGAAGG - Intronic
1157442385 18:47720847-47720869 GACGCTTGCTGGCCAAAGGAGGG + Intergenic
1158940035 18:62399351-62399373 GACGCTTTCTGGCCACATGATGG + Intergenic
1159559178 18:69975848-69975870 GATATTTGCGTGCCACAGGATGG - Intergenic
1159575878 18:70176737-70176759 GATGCTTGTGCACCACAGAATGG - Exonic
1161128861 19:2576402-2576424 GATGCTTGCTGACCCCAGGGAGG + Intronic
1163756896 19:19111602-19111624 CATGCTTGCTCTGCACAGCAGGG + Exonic
926304728 2:11629681-11629703 GATGCCTGCTTGGCACAGCAGGG + Intronic
929273405 2:39999315-39999337 GATGCTTGCTCACGACAGAATGG - Intergenic
930885982 2:56327404-56327426 AATGCATACTCACCACAGGAAGG - Intronic
931063479 2:58557370-58557392 GCCGCGTGCTCGCCTCAGGATGG - Intergenic
933934389 2:87189390-87189412 GATGGCTGCTGGCCTCAGGAAGG - Intergenic
936023460 2:109013188-109013210 CATAGTTGCTCGCCAAAGGAAGG - Intergenic
936358753 2:111776505-111776527 GATGGCTGCTGGCCTCAGGAAGG + Intronic
940421836 2:153488059-153488081 GATGCCTGGTAGCCAAAGGAAGG + Intergenic
946174026 2:217911817-217911839 AAAGCTTGTTCCCCACAGGAAGG - Intronic
947820592 2:233066475-233066497 GATGCTGGGTTGACACAGGAAGG - Intronic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1181310099 22:21939943-21939965 GATGGCTCCTGGCCACAGGAGGG + Intronic
1182365643 22:29777147-29777169 GATGCTTCCTAACCACAGGCTGG + Intergenic
1182619967 22:31613545-31613567 CCTGCCTGCTCCCCACAGGAAGG - Intronic
1182800524 22:33028563-33028585 GACGCTTGCTGGGCAGAGGAAGG + Intronic
1185212036 22:49575813-49575835 GATGCTTCCCCGTGACAGGAGGG - Intronic
949339517 3:3013652-3013674 TATGCTTGCTTTCCACAGAAAGG - Intronic
954423901 3:50433309-50433331 GATGCTTGCTTGCTACAACATGG - Intronic
956445135 3:69318636-69318658 GATGCTCGCTAGCAACAGAAAGG + Intronic
963795448 3:149626850-149626872 GCTGCTTGGTGGCCTCAGGACGG - Intronic
967921497 3:194617504-194617526 GTTGCTTGCTCGCCTTAGGGTGG - Intronic
969938047 4:10702483-10702505 GATGCATGCACATCACAGGATGG + Intergenic
972585446 4:40433344-40433366 GATGCCTGCTCCCTAGAGGAAGG + Intronic
975610716 4:76199988-76200010 GGAGCTTGCTCGGCAAAGGAAGG + Intronic
985631280 5:1015327-1015349 GAGGCTTCCTCTCTACAGGAAGG - Intronic
986138767 5:5009459-5009481 TATGCTTGTTCTCCACTGGAAGG + Intergenic
993044974 5:82856678-82856700 GATAGTGGGTCGCCACAGGAAGG - Intergenic
999821387 5:155232428-155232450 CATGCCTGCTCTGCACAGGAAGG - Intergenic
1003858952 6:10304338-10304360 GAGCATTGCTCCCCACAGGAAGG + Intergenic
1007181001 6:39929189-39929211 GCTGCTTACTCCCCACAGGATGG - Intronic
1007825161 6:44594758-44594780 GCTGCTGGCTGGCCCCAGGACGG - Intergenic
1011006778 6:82654433-82654455 TATGCTTTCCAGCCACAGGATGG - Intergenic
1012344510 6:98169826-98169848 GATGTTTGCATGCCAGAGGATGG + Intergenic
1015218941 6:130782152-130782174 GATGGCTGCTGGGCACAGGAAGG + Intergenic
1022947603 7:35302928-35302950 GATGCCTTCAAGCCACAGGATGG - Intergenic
1024123400 7:46267547-46267569 GATGTTTGCTCCCCACAGTTTGG - Intergenic
1024958325 7:54949574-54949596 GATGTTTGCATGCCAGAGGATGG - Intergenic
1025723619 7:64037927-64037949 CATGCTTGCTCCCCGCAGGCAGG - Intronic
1028254464 7:88576834-88576856 GCTACTTGCTGGCCATAGGATGG + Intergenic
1032660502 7:133978692-133978714 GCTGCTTCCTCGCAGCAGGAAGG - Intronic
1036202324 8:6779779-6779801 GCTCCTTGCTCGCCACTAGATGG - Intergenic
1036412858 8:8518799-8518821 GAAGCTTGCTTCCCACAGAATGG - Intergenic
1036761097 8:11508998-11509020 CCTGCTTGCTCCCCACAGGCTGG - Intronic
1040342636 8:46448636-46448658 GGTGCTTGGTCCCCACAGGGAGG - Intergenic
1041700707 8:60786195-60786217 GATGCTGGCTAGCAAAAGGAAGG - Intronic
1043880404 8:85535903-85535925 GAGGATTACTGGCCACAGGAGGG - Intergenic
1045492874 8:102683724-102683746 CATGCTGACTCGGCACAGGAGGG - Intergenic
1051580372 9:18666710-18666732 GAGGCTTTCTGGCCACATGATGG - Intronic
1202033320 Y:20603032-20603054 GATTCTTGCTCTCCATAGCATGG + Intergenic