ID: 916681363

View in Genome Browser
Species Human (GRCh38)
Location 1:167108155-167108177
Sequence CTGGATGAATGGATGGACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 865
Summary {0: 1, 1: 0, 2: 8, 3: 90, 4: 766}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916681363 Original CRISPR CTGGATGAATGGATGGACCA TGG (reversed) Intronic
900498136 1:2985870-2985892 GTGAATGAATGGATGGATGATGG - Intergenic
900498167 1:2986011-2986033 GTGAATGAATGGATGGAGGATGG - Intergenic
900498766 1:2989463-2989485 ATGGATGGATGGATGGATGATGG - Intergenic
900498784 1:2989543-2989565 ATGGATGAATGGATGGAGGATGG - Intergenic
900509425 1:3051531-3051553 ATGGATGGATGGATGGATGATGG - Intergenic
900509584 1:3052193-3052215 ATGAATGAATGGATGGATGATGG - Intergenic
900573347 1:3370883-3370905 ATGGATGAATGGATGGTGGATGG - Intronic
900573426 1:3371253-3371275 ATGGATGAATGGATGGTGGATGG - Intronic
900922004 1:5678790-5678812 ATGGATGGATGGATGGATGAGGG + Intergenic
900931020 1:5737659-5737681 ATGGATGGATGGATGGATGATGG + Intergenic
900931073 1:5738048-5738070 ATGGATGGATGGATGGACGGTGG + Intergenic
900993480 1:6108361-6108383 ATGGAGGAATGGAAGGACGAAGG + Intronic
901006601 1:6174699-6174721 ATGGATGAATGGATGGTGGATGG + Intronic
901006623 1:6174835-6174857 ATGGATGAATGGATGAATGACGG + Intronic
901006743 1:6175406-6175428 ATAGATGAATGGATGGATGACGG + Intronic
901098811 1:6703347-6703369 CTGGAAGAGCTGATGGACCATGG - Intergenic
901212127 1:7532746-7532768 ATGAATGAGTGGATGGATCAAGG + Intronic
901320887 1:8339256-8339278 CTGGATAGATGGCAGGACCAGGG - Intronic
901699871 1:11039580-11039602 CTGGAAGGATGGATGGATGATGG + Intronic
901928784 1:12583713-12583735 ATGCATGAATGGATGGAGTAGGG - Intronic
902058303 1:13620452-13620474 CTGGATCTGTGGATGGCCCAGGG + Intergenic
902412856 1:16221587-16221609 ATGGATGGATGGATGGATGATGG + Intergenic
902599040 1:17528624-17528646 ATGAATGAATGGATGGAGGATGG - Intergenic
902603883 1:17558106-17558128 ATGGATGGATGGATGGACAATGG - Intronic
902671970 1:17980807-17980829 TTGGATGAATGGATGGATGGGGG - Intergenic
902709530 1:18229196-18229218 CTGGAGGAAGTGATGGAGCATGG + Intronic
902721208 1:18305383-18305405 ATGGATGGATGGATGGATAATGG + Intronic
902721222 1:18305471-18305493 ATGGATGGATGGATGGATGATGG + Intronic
902721240 1:18305560-18305582 ATGGATGGATGGATGGATTATGG + Intronic
902721244 1:18305579-18305601 ATGGATGGATGGATGGATGATGG + Intronic
902722825 1:18315530-18315552 TTGGATGAGTGGATGGATGATGG + Intronic
902968341 1:20028652-20028674 CTGGATGACTGCCTGGACAAGGG + Intronic
903030450 1:20460267-20460289 ATAGATGGATGGATGGATCATGG + Intergenic
903175173 1:21576236-21576258 ATGGATGGATGGATGGATGATGG + Intronic
903234459 1:21940659-21940681 ATGAATGAATGAATGGACAAAGG - Intergenic
903341742 1:22659063-22659085 ATGGATGGATGGATGGACAGGGG + Intronic
903690428 1:25169326-25169348 ATGGATGGATGGATGGATGATGG + Intergenic
904464524 1:30699979-30700001 ATGGATGGATGGATGGATGAAGG - Intergenic
904465112 1:30702955-30702977 ATGGATGGATGGATGGATGATGG + Intergenic
904581269 1:31545946-31545968 ATGGATGAATGGATGGATGGAGG - Intergenic
904581357 1:31546517-31546539 ATGGATGGATGGATGGATGATGG - Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905274627 1:36809197-36809219 ATGGATGGATGGATGGATGATGG - Intronic
905479290 1:38250145-38250167 ATGGATGATGGGATAGACCATGG + Intergenic
906180686 1:43815915-43815937 ATGGATGGATGGATGGATGATGG + Intronic
906203350 1:43973998-43974020 CTGGAAGAGTGGAAGCACCATGG - Intergenic
907774266 1:57498029-57498051 ATGGATGAATGGATGGATCAAGG + Intronic
907839884 1:58146818-58146840 ATGGATGGATGGATGGATAAAGG - Intronic
908391370 1:63686692-63686714 ATGGATGGATGGATGGATGAAGG - Intergenic
908391400 1:63686850-63686872 ATGGATGAATGGATGGGGGATGG - Intergenic
908414277 1:63897873-63897895 CTGAATGACTGTATGGAGCAGGG - Intronic
908437474 1:64120830-64120852 GTGGATGGATGGATGGAGAATGG + Intronic
908680373 1:66654095-66654117 CTGGGTGGATGGATGCACCACGG + Intronic
909107645 1:71432717-71432739 CTGGATGAATTGTTGGATCAAGG - Intronic
911671584 1:100614317-100614339 CTGACTGAATGGAAGGAACATGG - Intergenic
912336283 1:108866075-108866097 CTGGATGAAGGGATAAAGCATGG + Intronic
912379082 1:109237160-109237182 CTGGTTGAATGGATGGTTCCTGG + Intronic
913964409 1:143363498-143363520 ATGGATGAATGGATGAACACAGG + Intergenic
914058778 1:144189104-144189126 ATGGATGAATGGATGAACACAGG + Intergenic
914120371 1:144777267-144777289 ATGGATGAATGGATGAACACAGG - Intergenic
916578183 1:166085573-166085595 CTGAATGAATGAATGAACCAGGG + Intronic
916681363 1:167108155-167108177 CTGGATGAATGGATGGACCATGG - Intronic
917492829 1:175512940-175512962 CTAAATGACTGAATGGACCAAGG + Intronic
918427312 1:184423854-184423876 ATGGATGGATGGATGGACGATGG - Intronic
919935098 1:202245975-202245997 ATGGATGAATGGATAGATGAAGG - Intronic
919935117 1:202246034-202246056 ATGGATGAATGGATGGATGGAGG - Intronic
919935127 1:202246066-202246088 ATGGATGAATGGATAGATGAAGG - Intronic
919935247 1:202246397-202246419 ATGGATGAATGGATAGATGAAGG - Intronic
920195429 1:204223309-204223331 ATGGATGAATGGATGGATAGTGG + Intronic
920646318 1:207806738-207806760 CTGGATGGGAGGATGCACCAAGG + Intergenic
920700588 1:208215529-208215551 ATGGATGAAGGGATGGAGGAAGG + Intronic
921501460 1:215909298-215909320 ATGAATGAATAGATGGAACACGG + Intronic
921734573 1:218612372-218612394 ATGGGTGAGTGGATGGACCCAGG + Intergenic
922745707 1:228042385-228042407 CTGGATGGATGGATGGATGATGG + Intronic
922792836 1:228319623-228319645 GTGGATGGATGGATGAACGATGG - Intronic
924395132 1:243610556-243610578 TTGGATGAATGGATGACCAAGGG - Intronic
924509642 1:244718849-244718871 AGGGATGAATGGGTGGAGCACGG - Intergenic
1063378647 10:5570355-5570377 CTGGAGGAAAGGGTGGGCCATGG + Intergenic
1063438323 10:6052464-6052486 CTGAATGAATGAATGAACAAAGG + Intronic
1063438926 10:6056287-6056309 ATGCATGAATGGATGGATGAAGG + Intronic
1063896115 10:10684113-10684135 CGGGATGAAGGGATGAAGCACGG + Intergenic
1064001606 10:11668197-11668219 CTGGAAGAAGGGATGGAAAAGGG + Intergenic
1064896381 10:20241954-20241976 ATGGATGGATGGATGGAGAAAGG + Intronic
1065951642 10:30657783-30657805 ATGGATGAGTGGATGGAGAAAGG - Intergenic
1066229333 10:33416910-33416932 GTGGATGGATGGATGGATGATGG + Intergenic
1066258502 10:33705325-33705347 TTGGATGAATGGATGAAGCTGGG - Intergenic
1067051422 10:43023554-43023576 ATGGATGAATGGATGGATGATGG + Intergenic
1067051489 10:43024059-43024081 ATGGATAAATGGATGGATGATGG + Intergenic
1067142019 10:43666286-43666308 CTGGATTAATGGATTGATGAAGG - Intergenic
1067471775 10:46543000-46543022 CTGGGTGAATGGAAGGACTTTGG - Intergenic
1069039995 10:63685429-63685451 CTGGAGGAGTCGGTGGACCAGGG - Intergenic
1069165724 10:65156369-65156391 ATGGAGGAATGTATGCACCAGGG + Intergenic
1069601630 10:69711869-69711891 ATGGATGGATGGATGGATGATGG - Intergenic
1070091666 10:73291968-73291990 CTGGATCACTGGTTGGACTATGG - Exonic
1070440082 10:76434582-76434604 ATGGATGAGTGGATGGCCTAAGG - Intronic
1070749902 10:78957851-78957873 ATGGATGGATGGATGGATGAAGG + Intergenic
1070760245 10:79019729-79019751 ATGGATGGATGAATGGACAATGG + Intergenic
1070826622 10:79393962-79393984 CTGGCCGACTGGATGGATCAAGG + Intronic
1071508580 10:86247369-86247391 ATGGATGGATGGATGGATGATGG + Intronic
1071746391 10:88424316-88424338 CTGGAAGACTGGATGAAGCAAGG + Intronic
1073444728 10:103573950-103573972 GTGGACGTATGGACGGACCAAGG - Intronic
1073467166 10:103700945-103700967 ATGGATGGATGGATGGATGATGG - Intronic
1073467191 10:103701059-103701081 ATGGATGGATGGATGGATGATGG - Intronic
1073467233 10:103701269-103701291 ATGGATGAATGGATAGATGATGG - Intronic
1073467236 10:103701292-103701314 ATGGATGAATGGATGGATGATGG - Intronic
1073467240 10:103701315-103701337 ATGGATGAATGGATGGATGATGG - Intronic
1073467250 10:103701357-103701379 ATGGATGAATGGATAGATGATGG - Intronic
1073467275 10:103701488-103701510 ATGGATGAATGGATGGATGATGG - Intronic
1073467290 10:103701556-103701578 ATGGATGAATGGATAGATGATGG - Intronic
1074007649 10:109444481-109444503 CTAGGTGAATGTATGGAACAGGG - Intergenic
1074905385 10:117858225-117858247 ATGGATGGATGGATGGATAATGG - Intergenic
1075237265 10:120742196-120742218 GTTGATGAATAGATGGCCCAGGG + Intergenic
1075648258 10:124110487-124110509 ATGGATGGATGGATGGATGATGG + Intergenic
1075712857 10:124540123-124540145 CTGCATGAACGGCTGGGCCAGGG - Intronic
1076122073 10:127944345-127944367 GTGGATGGATGGATGGACGATGG + Intronic
1076136725 10:128050242-128050264 ATGGATGGATGGATGGATGATGG + Intronic
1076494436 10:130887636-130887658 ATGGATGGATGGATGGATGAAGG + Intergenic
1076602836 10:131670116-131670138 ATGGATGAATGGATGAATGATGG + Intergenic
1076676720 10:132150900-132150922 ATGGATAAATGGATGGATTAAGG - Intronic
1077236651 11:1485103-1485125 CTGGATGCATGGAGGGGCCGAGG - Intronic
1077280530 11:1743029-1743051 GTGGATGGATGGATGGATGAAGG + Intronic
1077280541 11:1743067-1743089 ATGGATGGATGGATGGAGGATGG + Intronic
1077280588 11:1743339-1743361 ATGGATGGATGGATGGAGGATGG + Intronic
1077280595 11:1743377-1743399 ATGGATGAATGGATGGAAGATGG + Intronic
1077452615 11:2658552-2658574 CTGGATGAATGGATGATTCTAGG - Intronic
1077480881 11:2814000-2814022 ATGGATGGATGGATGGATGATGG + Intronic
1077728561 11:4703198-4703220 CTGGTTGTCTGGTTGGACCAAGG + Intergenic
1078507821 11:11965548-11965570 CTTCATGAGTGGATGGTCCATGG - Intronic
1080781489 11:35433828-35433850 ATGGATGGATGGATGGATGAGGG + Intronic
1080849360 11:36054893-36054915 ATGGATGAATGGATGGATGATGG + Intronic
1081287183 11:41285246-41285268 ATGAATGAATGGATGGATGATGG - Intronic
1081534476 11:43987172-43987194 ATGGATGGAAGGATGGACAAAGG - Intergenic
1081678979 11:44988631-44988653 TTGGATGGATGGATGGACGATGG + Intergenic
1081996244 11:47366113-47366135 CATGATGAATGGATGGATGAAGG - Intronic
1082007073 11:47425339-47425361 CTGGATGAATGGATGCGGGAGGG - Intronic
1082781382 11:57290190-57290212 ATGGATGGATGGATGGATGAAGG + Intergenic
1082898841 11:58223532-58223554 CTGGATGAAGGGAATGAGCAGGG + Intergenic
1083368991 11:62163529-62163551 CTGGAGGAATGTTTGCACCATGG - Intergenic
1083622405 11:64055699-64055721 ATGGATGGATGGATGGATGATGG + Intronic
1083879843 11:65542978-65543000 ATGGATGGATGGATGGATGAAGG + Intronic
1083879852 11:65543013-65543035 GTGGATGGATGGATGGAGAAAGG + Intronic
1083977998 11:66139655-66139677 TTGGATGGATGGATGAAACATGG - Intronic
1084036703 11:66515709-66515731 CTGAGTGACTGGATGGACAAAGG - Exonic
1084464707 11:69315475-69315497 ATGGATGGATGGATGGATAATGG + Intronic
1084543830 11:69803775-69803797 ATGGATGGATGGATGGATGATGG + Intergenic
1084543847 11:69803888-69803910 ATGGATGGATGGATGGATGATGG + Intergenic
1084576540 11:69992238-69992260 ATGGATGGATGGATGGATGATGG + Intergenic
1084579222 11:70012347-70012369 ATGGATGGATGGATGGATGAAGG - Intergenic
1084579265 11:70012688-70012710 ATGGATGGATGGATGGATGAAGG - Intergenic
1084596422 11:70119445-70119467 ATGGATGGATGGATGGCCGATGG + Intronic
1084605287 11:70168589-70168611 CTGACTGAATGGATGAACAAAGG + Intronic
1084658813 11:70535409-70535431 ATGGATGGATGGATGGATGATGG - Intronic
1084705120 11:70811622-70811644 ATGGATGAGTGGATGGATGATGG - Intronic
1084713530 11:70859189-70859211 CTGGATGGATGGGTGGATGAGGG + Intronic
1084781886 11:71415141-71415163 ATGGGTGAATGGATGGATGATGG + Intergenic
1085406867 11:76268657-76268679 ATGGATGGATGGATGGAGGATGG - Intergenic
1085855257 11:80169053-80169075 CTGGAAGACTGGATGGGGCAGGG - Intergenic
1086401979 11:86468335-86468357 ATGGATGGATGGATGGATGATGG - Intronic
1087871948 11:103305749-103305771 GTGAATGAGTTGATGGACCATGG + Intronic
1087882903 11:103439780-103439802 CTGAATGAATGAATGAACAAAGG + Intronic
1088375027 11:109131623-109131645 ATGGATGAATGGATGGTTAAAGG + Intergenic
1088770623 11:113032381-113032403 CTGAATGACTGTATGGAGCAGGG - Intronic
1090140976 11:124261177-124261199 GTGGATGGATGGATGGATAAAGG - Intergenic
1090675174 11:128985678-128985700 ATGAATGAATGGATGGACAAAGG - Intronic
1091187304 11:133658294-133658316 ATGGATGGATGGATGGATGATGG + Intergenic
1091216806 11:133907232-133907254 CTGGGTGAAAGGAAGGACCAGGG + Intergenic
1091407333 12:217381-217403 ATGGATGGATGGATGGAGGATGG + Intergenic
1091949015 12:4576160-4576182 AAGGATGAATAGATGGACAATGG - Intronic
1092488434 12:8922827-8922849 CAGGATGAAGGGAATGACCACGG + Intronic
1092602188 12:10079273-10079295 GTGGATGGATGGATGGATAATGG + Intronic
1093416319 12:18925041-18925063 CTGGATGCCTGGAAGGACAAAGG + Intergenic
1094780011 12:33780204-33780226 GGGGATGAATAGATGGACCATGG - Intergenic
1096611227 12:52803312-52803334 ATGGATGAATAGATGGATGATGG + Intergenic
1097251981 12:57639599-57639621 CTGGATGGATGGATGGAGCCCGG + Intergenic
1097687172 12:62702008-62702030 ATGGATGAATGAATGAACAAAGG + Intronic
1097996433 12:65892740-65892762 CAGGATGAATGGATTGAGGACGG - Intronic
1098280125 12:68854278-68854300 CTGAATGAATGAATGAACAAGGG - Exonic
1099688548 12:85921535-85921557 ATGGATGTATGGATGGACGGAGG + Intergenic
1100096946 12:91051940-91051962 ATGGATGGATGGATGGATCCTGG + Intronic
1100558812 12:95726493-95726515 CTTGATGAATGGATAAACTATGG - Intronic
1100932741 12:99629192-99629214 CTGAGTGAATGGATGGTCTATGG - Intronic
1101007377 12:100414202-100414224 CTGGAATAATGGAAGGAGCACGG - Intronic
1102009258 12:109607914-109607936 CTGGATGAATGGATGCATAAAGG + Intergenic
1102043181 12:109813965-109813987 ATAGATGAATGGATGGATGATGG + Intronic
1102895620 12:116595853-116595875 ATGGATGGATGGATGGATGAAGG + Intergenic
1103012774 12:117469997-117470019 ATGGATGGATGGATGGATGAAGG - Intronic
1103331857 12:120159787-120159809 CTGGCTGCAGGGATGGCCCAGGG - Intronic
1103617944 12:122166927-122166949 TTGGATTGATGGATTGACCAAGG - Intergenic
1103728364 12:123010266-123010288 CTGAATGAATGAATGCACCAAGG - Intronic
1103834325 12:123807128-123807150 ATGGATGGATGGATGGATGATGG - Intronic
1103941449 12:124503467-124503489 ATGGATGGATGGATGGATGATGG + Intronic
1103941455 12:124503498-124503520 ATGGATGGATGGATGGACAGAGG + Intronic
1104034722 12:125090357-125090379 ATGGATGAATAGATGGATGACGG - Intronic
1104034774 12:125090720-125090742 ATGGATGGATGGATGGATGATGG - Intronic
1104075695 12:125387792-125387814 ATGGATGGATGGATGGATAACGG - Intronic
1104567607 12:129899325-129899347 ATGGATGGATGGATGGATGATGG + Intronic
1104706220 12:130949525-130949547 CGGGATCAATAGATTGACCATGG - Intergenic
1104772618 12:131372966-131372988 ATGGATGGAAGGATGGACAAAGG - Intergenic
1104778404 12:131404630-131404652 ATGGATGGATGGATGGATGATGG - Intergenic
1104778423 12:131404708-131404730 ATGGATGGATGGATGGATGATGG - Intergenic
1104778488 12:131404956-131404978 GTGGATGGATGGATGGATGACGG - Intergenic
1104778565 12:131405252-131405274 GTGGATGGATGGATGGATGATGG - Intergenic
1104778641 12:131405513-131405535 GTGGATGGATGGATGGATGATGG - Intergenic
1104896313 12:132166671-132166693 ATGGGTGAATGGATGGATGATGG - Intergenic
1104896439 12:132167148-132167170 GTGGATGAATGGATGGATAAGGG - Intergenic
1105693848 13:22869301-22869323 ATGGATGGATGGATGGACGGAGG + Intergenic
1105705513 13:22965569-22965591 CAGGATGAAGGGATGGGCCTTGG - Intergenic
1106000584 13:25719479-25719501 ATGGATGGATGGATGGATGATGG + Intronic
1106448997 13:29862872-29862894 CTGGATGTAGGGAGGCACCATGG - Intergenic
1107899481 13:44997752-44997774 GTGGATGAATGGGTGGACCATGG - Intronic
1108708336 13:53010162-53010184 CTTAATAAATGGATGGACCTAGG + Intergenic
1110752517 13:79131803-79131825 TTGAATGAATGGATGGATGAAGG - Intergenic
1113072883 13:106438685-106438707 ATGGATGGATGGATGGATGATGG + Intergenic
1113597726 13:111546546-111546568 CTGGATGGAGGGAGGGGCCATGG - Intergenic
1113603761 13:111590156-111590178 CTGGATGGATGGATAGGCGATGG + Intronic
1114243835 14:20894019-20894041 CTGGATGAATGAATGAACGAAGG - Intergenic
1116268397 14:42727190-42727212 ATGGATGGATGGATGGAAGATGG - Intergenic
1117016636 14:51525172-51525194 ATGGATGGATGGATGGATAAAGG + Intronic
1118851637 14:69588255-69588277 TTGGATGGATGGATGGATGATGG - Intergenic
1121062234 14:90923425-90923447 ATGGATGGATGGATGGATGATGG - Intronic
1121277444 14:92677912-92677934 ATGGATGCATGGATGGATGACGG - Intronic
1121739969 14:96244806-96244828 ATGGATGCATGGATGGAGGAGGG - Intronic
1122813205 14:104299117-104299139 ATGGATGGATGGATGGAAGATGG - Intergenic
1122823597 14:104359195-104359217 CTGGAAGCAGGGATGGCCCAAGG - Intergenic
1122910240 14:104824290-104824312 GTGGATGATTGGATGGGTCAGGG + Intergenic
1123083171 14:105705609-105705631 ATGGATGGATGGATGGATGATGG - Intergenic
1124395798 15:29300316-29300338 ATGGATGGATGGATGGATGATGG + Intronic
1124864341 15:33474226-33474248 CTGGATGCATGGATGGATGGTGG + Intronic
1124897611 15:33791557-33791579 GTGGAAGAATAGATGCACCAGGG + Intronic
1126584242 15:50267189-50267211 TTGGATGAATGGACGGTCAAGGG - Intergenic
1128265211 15:66260117-66260139 ATGGATGAATGAATGGATGATGG + Intergenic
1128518934 15:68362660-68362682 ATGGATAAATGGATGGAAGATGG + Intronic
1130136590 15:81186786-81186808 ATGGATGCATGGATGGACAGAGG - Intronic
1130353615 15:83111287-83111309 ATGGATGAATTGATGGATGATGG - Intronic
1130353623 15:83111339-83111361 ATGGATGAATTGATGGATGATGG - Intronic
1130353638 15:83111423-83111445 ATGGATGAATGGATAGATGATGG - Intronic
1131066032 15:89435627-89435649 CTGGATAAAGGGACGGACAAAGG - Intergenic
1131439996 15:92452508-92452530 CAGGAGGAAAGGATGGACAATGG + Intronic
1131886436 15:96919516-96919538 ATGGATAAATGGATAAACCATGG - Intergenic
1132019069 15:98344853-98344875 GTGGATGAATGGATGGATGGTGG + Intergenic
1132030850 15:98437694-98437716 ATGGATGGATGGATGGAGGATGG + Exonic
1132030857 15:98437721-98437743 ATGGATGGATGGATGGATGATGG + Exonic
1132030881 15:98437847-98437869 ATGGATGGATGGATGGAAGATGG + Exonic
1132030914 15:98437981-98438003 ATGGATGGATGGATGGATGATGG + Exonic
1132030931 15:98438060-98438082 ATGGATGAATGGATGGATGGAGG + Exonic
1132653736 16:1032936-1032958 ATGGATGGATGGATGGATGATGG - Intergenic
1132653854 16:1033506-1033528 ATGGATGGATGGATGGATGATGG - Intergenic
1132976429 16:2713431-2713453 CTGGTTGAATGCATAGCCCATGG + Intronic
1133204833 16:4227056-4227078 ATGGATGGATGGATGGATGATGG + Intronic
1133326834 16:4947081-4947103 ATGGATGAATGGATGGATGGAGG - Intronic
1133326873 16:4947257-4947279 ATGGATGGATGGATGGAGGAAGG - Intronic
1133456144 16:5944015-5944037 CTGGATGAATGGATGGTGGATGG - Intergenic
1134226192 16:12392437-12392459 ATGGATGAATGGCTGGAGCAGGG - Intronic
1134466710 16:14485355-14485377 ATGGAAGAATGGGTGGACAATGG - Intronic
1134488430 16:14677723-14677745 ATGGATGGATGGATGGATGATGG + Intronic
1134788004 16:16962459-16962481 ATGGATGGATGGATGGATGAAGG + Intergenic
1134819850 16:17238088-17238110 GTGGATGAATGGAAAGGCCAGGG - Intronic
1134819986 16:17239278-17239300 GTGGATGGATGGATGGATCATGG - Intronic
1134820015 16:17239416-17239438 GTAGATGGATGGATGGATCATGG - Intronic
1135234439 16:20742197-20742219 CTGGATGAATGAATGCCTCAAGG - Intronic
1136071396 16:27789700-27789722 ATGGATGGATGGATGGATGATGG + Exonic
1136071407 16:27789776-27789798 ATGGATGAATGGATAGATAATGG + Exonic
1136071449 16:27790060-27790082 ATGGATGAATGGATAGATGATGG + Exonic
1136289149 16:29261144-29261166 CTGGGTGATTGGAAGGGCCATGG + Intergenic
1136290811 16:29270303-29270325 ATGGATGGATGGATGGATAAAGG + Intergenic
1136638804 16:31544196-31544218 CTGGATGTATAGATAGACTATGG - Intergenic
1137386134 16:48044143-48044165 CTGGATGGATGGATGGTGAATGG - Intergenic
1137386165 16:48044316-48044338 GTGGATCAATGGATGGATGATGG - Intergenic
1137601623 16:49760170-49760192 ATGGATGGATGGATGGATGAGGG + Intronic
1137625611 16:49906099-49906121 ATGGATGGATGGATGGATGATGG + Intergenic
1137821999 16:51455036-51455058 CTGGTTCAATGGATAGACCAAGG + Intergenic
1137977060 16:53040985-53041007 GTGGATGGATGGATGGATAATGG + Intergenic
1138244035 16:55453097-55453119 ATGGATGGATGGATGGATAAAGG - Intronic
1138279840 16:55764339-55764361 CTGGATGAGAGGATGAACAAGGG - Intergenic
1138440362 16:57030648-57030670 ATGGATGGATGGATGGATGAAGG + Intronic
1138495671 16:57407745-57407767 ATGGATGGATGGATGGATGATGG - Intronic
1138547764 16:57729691-57729713 ATGGATGGATGGATGGATGATGG + Intronic
1138547854 16:57730050-57730072 ATGGATGGATGGATGGATGATGG + Intronic
1139201926 16:64986702-64986724 ATGGATGAATGGTAGGACCGAGG - Intronic
1139982737 16:70872795-70872817 CTGCATGGATGGATGGATGATGG - Intronic
1140853239 16:78954230-78954252 TTGGATGATTGGATGGATGATGG + Intronic
1141110130 16:81265422-81265444 ATGGATGAATGGATGGATGGTGG - Intronic
1141110183 16:81265624-81265646 ATGGATGAATGGATGGATGGTGG - Intronic
1141115133 16:81302031-81302053 ATGGATGGATGGATGGAGCTGGG - Intergenic
1141597031 16:85103693-85103715 CTGCATGAATGAATGCACAAGGG - Intronic
1141606498 16:85156941-85156963 ATGGATGGATGGATGGAGAAAGG - Intergenic
1141641822 16:85346111-85346133 ATGGATGGATGGATGAACAATGG + Intergenic
1141641839 16:85346178-85346200 ATGGATGGATGGATGAACAATGG + Intergenic
1141641943 16:85346612-85346634 ATGGATGGATGGATGGATGATGG + Intergenic
1141641988 16:85346821-85346843 ATGGATGGATGGATGGATGATGG + Intergenic
1141650012 16:85387932-85387954 ATGGATGGATGGATGGATAAAGG + Intergenic
1141663619 16:85454484-85454506 CTGGCTGCATGGATGCTCCAGGG - Intergenic
1142094877 16:88234071-88234093 CTGGGTGATTGGAAGGGCCATGG + Intergenic
1142152386 16:88518401-88518423 GTGGATGGATGGATGGATGATGG + Intronic
1142152470 16:88518757-88518779 ATGGATGGATGGATGGATGATGG + Intronic
1142152563 16:88519134-88519156 ATGGATGGATGGATGGATGATGG + Intronic
1142960532 17:3549715-3549737 ATGGATGGATGGATGGAGGATGG + Intronic
1142960552 17:3549877-3549899 ATGGATGGATGGATGGAGGATGG + Intronic
1143009981 17:3860916-3860938 CTGGAAACATGGATGGACAAGGG - Intronic
1143301240 17:5912083-5912105 ATGGATGAATGGATGGAAGATGG - Intronic
1143301246 17:5912118-5912140 ATGGATGAATGGATGGAAGATGG - Intronic
1143301490 17:5913855-5913877 ATGGATGGATGGATGGAAGATGG - Intronic
1143536420 17:7542876-7542898 TTGAATGAATGGGTGGTCCAAGG - Intergenic
1143766321 17:9139903-9139925 ATGGATGAATGGATGGATGATGG - Intronic
1143766328 17:9139945-9139967 ATGGATGAATGAATGGATGATGG - Intronic
1144100697 17:11939828-11939850 ATGGATGGATGGATGGATGATGG + Intronic
1145271658 17:21407990-21408012 ATGGATGGATGGATGGATGATGG - Intronic
1145321050 17:21767615-21767637 CTGGAAGAATGGGGGGAGCACGG + Intergenic
1145898168 17:28472861-28472883 ATGGATGGATGGATGGATGATGG + Intronic
1145979270 17:29002261-29002283 CTGGATGGATGGAGGGGCTAAGG + Intronic
1146489236 17:33268338-33268360 ATGGATGGATGGATGGATGATGG - Intronic
1146562818 17:33886181-33886203 CTGGCTGAAGAGATGGACAAAGG + Intronic
1146648925 17:34594241-34594263 CGGGATGAATGAATGAACCTGGG + Intronic
1146701063 17:34960911-34960933 CTTGTTGAATTTATGGACCAAGG + Intronic
1146820919 17:35983065-35983087 ATGGATGGATGGATGGATGAAGG - Intergenic
1147977503 17:44256183-44256205 ATGGATGAATAGATGGATAATGG - Intronic
1148235994 17:45969538-45969560 ATGGATGGATGGATGAACCGAGG - Intronic
1148236013 17:45969641-45969663 ATGGATGGATGGATGAACCGAGG - Intronic
1149804568 17:59603236-59603258 ATGGATGCATGGATGGACACTGG + Intronic
1150220675 17:63494126-63494148 CTGGGTGTCTGGATGGGCCAGGG + Intronic
1150631426 17:66883050-66883072 ATGGAAGAATGGATGGATGATGG - Intronic
1150699197 17:67433093-67433115 CTGGATGAATCGTGGGAGCAAGG + Intronic
1151325756 17:73379063-73379085 CTGGATGAATGGAGGGCCTGGGG + Intronic
1151722391 17:75864807-75864829 CTGGAGGAGAGGAGGGACCAGGG + Intergenic
1151943281 17:77305924-77305946 GTGGATGGATGGATGGATGATGG + Intronic
1152034054 17:77861163-77861185 ATGGATGAATGGATGGAGGATGG + Intergenic
1152038019 17:77885225-77885247 ATGGATGGATGGATGGAGGATGG + Intergenic
1153381338 18:4442993-4443015 ATGAATGAATGGATTGACAATGG + Intronic
1154307969 18:13244153-13244175 GTGGATGAATGGATGGATAGAGG - Intronic
1155391003 18:25336627-25336649 CTGGATCAATGCATTGGCCAGGG + Intronic
1155539313 18:26850705-26850727 AGGGATGGATGGATGGATCATGG - Intergenic
1155539319 18:26850728-26850750 ATGGATGGATGGATGGATGATGG - Intergenic
1155580904 18:27305290-27305312 CTGGAGCAATGGATGGATCCAGG - Intergenic
1156046774 18:32886165-32886187 GTGGTGGAATGGATGGACAAGGG + Intergenic
1156471694 18:37381107-37381129 ATGGATGGATGGATGGATGATGG - Intronic
1156477426 18:37414795-37414817 CTGGATGGATGGATGAATTAGGG - Intronic
1158549100 18:58419796-58419818 CTGGATGGATGGATGGATGGAGG + Intergenic
1159120917 18:64169628-64169650 ATGGATGGATGGATGGACAGAGG - Intergenic
1160502519 18:79409294-79409316 ATGGAGGAATGGATGGATGATGG - Intronic
1160502561 18:79409525-79409547 GTGGATGAATGGATGGATGATGG - Intronic
1160907324 19:1457459-1457481 CTGAATGCATGGATGGATCGTGG + Intronic
1160926593 19:1549637-1549659 ATGGATGGATGGATGGATGAAGG - Intergenic
1160960241 19:1717713-1717735 ATGGATGGATGGATGGAACATGG + Intergenic
1161049782 19:2157095-2157117 ATGGATGGATGGATGGATGATGG - Intronic
1161105242 19:2440544-2440566 GTGGATGGATGGATGGATGATGG - Intronic
1161105248 19:2440567-2440589 GTGGATGGATGGATGGATGATGG - Intronic
1161258539 19:3322991-3323013 GTGGATGGATAGATGGACAAAGG + Intergenic
1161287624 19:3477108-3477130 ATGGATGGATGGATGGATCATGG + Intronic
1161449122 19:4334806-4334828 ATGGATGAGTGGATGGATGATGG - Intronic
1161449147 19:4334921-4334943 GTGGATGGATGGATGGATTATGG - Intronic
1161633119 19:5369343-5369365 GTGGATGAATAGATGGATGATGG - Intergenic
1161633657 19:5373398-5373420 CTGGATGAATGGATGGCACATGG + Intergenic
1161657498 19:5525098-5525120 ATGGGTGAATGGATGGATGATGG - Intergenic
1161768977 19:6221247-6221269 ATGAATGAATGGATGGATGAGGG - Intronic
1162085832 19:8248636-8248658 TTGGATGAGTGGATGGATGATGG + Intronic
1162085858 19:8248753-8248775 TTGGATGGATGGATGGATGATGG + Intronic
1162085944 19:8249187-8249209 TTGGATGGGTGGATGGACGATGG + Intronic
1162321281 19:9972286-9972308 GTGAATGAATGGATGAACGAGGG - Intronic
1163218175 19:15895988-15896010 ATGGATGGATGGATGGATGATGG - Intronic
1163238425 19:16043381-16043403 ATGGATGAATGGGTGGAGGATGG + Intergenic
1163238454 19:16043500-16043522 ATGGATGAATGGATGGAGGGAGG + Intergenic
1163383546 19:16985272-16985294 GTGGATGAATGGATGGATGAAGG + Intronic
1163383586 19:16985456-16985478 ATGGATGGATGGATGGATGAAGG + Intronic
1163409629 19:17145936-17145958 ATGGATGGATGGATGGATGATGG + Intronic
1163462268 19:17446181-17446203 ATGGATGGATGGATGGATGAGGG - Intronic
1163492700 19:17626189-17626211 ATGGATGGTTGGATGGACGATGG - Intronic
1164753154 19:30670784-30670806 CGGGCTGAAGGGATGGACCCGGG - Intronic
1164797296 19:31044403-31044425 ATGGATGGATGGATGGATGAAGG + Intergenic
1164797309 19:31044515-31044537 ATGGCTGAATGGATGGATGAAGG + Intergenic
1164829616 19:31310455-31310477 ATGGATGAATGGATGAACTCAGG + Intronic
1165144390 19:33722093-33722115 ATGGATGGATGGATGGATGAAGG + Intronic
1165380472 19:35476044-35476066 CTGGATGAAGTGAGGGAGCAAGG + Intergenic
1165787073 19:38468045-38468067 ATGGATGGATGGATGGATGATGG - Intronic
1165787101 19:38468204-38468226 ATGGATGGATGGATGGATGATGG - Intronic
1166167734 19:41004134-41004156 CCGGAAGAATGGGTCGACCATGG - Exonic
1166647678 19:44544195-44544217 ATGGATGGATGGATGGATGACGG - Intergenic
1167086853 19:47315932-47315954 ATGGATGGATGGATGGATAATGG - Intronic
1167144166 19:47672132-47672154 ATGGATGGAAGGATGGAGCATGG + Intronic
1167161417 19:47769727-47769749 ATGGATGGATGGATGGATGATGG - Intergenic
1167161425 19:47769762-47769784 ATGGATGGATGGATGGATGATGG - Intergenic
1167168964 19:47818337-47818359 ATGGATGGATGGATGGATGATGG - Intronic
1167168984 19:47818415-47818437 ATGGATGGATGGATGGACGGAGG - Intronic
1167233775 19:48301731-48301753 CTGGATGGATGGATGGACATGGG + Intronic
1167233785 19:48301773-48301795 CTGCATGGATGGATGGACATGGG + Intronic
1167277626 19:48548433-48548455 ATGGATGAATGGATAGATGAAGG + Intergenic
1167277644 19:48548535-48548557 CTAGATGAATGGATGGAAAATGG + Intergenic
1167339035 19:48903962-48903984 GTGGATGGATGGATGGATGATGG + Intronic
1167389076 19:49182349-49182371 ATGGATGGATGGATGGACAGAGG - Intronic
1167527497 19:49994143-49994165 CTGGAGGGATGGACGTACCAAGG - Intronic
1167556046 19:50196394-50196416 ATGGATGGATGGATGGATGATGG - Intronic
1167601287 19:50456289-50456311 ATGGATGGATGGATGGATGATGG - Intronic
1168508267 19:56954585-56954607 ATGGATGGATGGATGGATAAGGG - Intergenic
1202698181 1_KI270712v1_random:140989-141011 ATGGATGAATGGATGAACATAGG + Intergenic
925347763 2:3182906-3182928 CTGGATGGGTGGATGGATGATGG - Intergenic
925489250 2:4373838-4373860 ATGGATAAATGGATGGAATAAGG - Intergenic
925541185 2:4969547-4969569 ATGGATGGATGGATGGATGATGG - Intergenic
925925640 2:8668184-8668206 ATGGGTGAATGGATGGATAAAGG + Intergenic
925925677 2:8668372-8668394 ATGGATGGATGGATGGATGAAGG + Intergenic
926214018 2:10892604-10892626 ATGGATGGATGGATGGAAGAAGG - Intergenic
926698637 2:15787991-15788013 ATGGATGAATGGATGGAGTATGG - Intergenic
927174185 2:20393836-20393858 CAGCAGGTATGGATGGACCATGG - Intergenic
927197747 2:20559732-20559754 ATGGATGGATGGATGGATGATGG + Intergenic
928177512 2:29044965-29044987 ATGGATGGATGGATGGATGATGG - Intronic
930361112 2:50381120-50381142 CAGAATGAATGAATGGAACATGG + Intronic
931401720 2:61937437-61937459 CTGAAGGACAGGATGGACCAGGG - Intronic
931972339 2:67602639-67602661 ATGGATGGATGGATGGATGATGG + Intergenic
932323209 2:70837116-70837138 ATGGATGAATGGATGGATAGAGG + Intergenic
933968216 2:87447991-87448013 CTGGATGGATGGATGGTAGATGG + Intergenic
934279436 2:91598772-91598794 ATGGATGAATGGATGAACACAGG + Intergenic
934920247 2:98337875-98337897 CTGGATGGATGGATGGATGATGG - Intronic
935068459 2:99673361-99673383 CAGGATGAATGGGGGGACCTGGG - Intronic
935272703 2:101448912-101448934 CTGGTTGTATGGATGGACAGTGG + Intronic
935782322 2:106519059-106519081 ATGGATGGATGGATGGATGATGG - Intergenic
936243980 2:110810636-110810658 ATGGATGGATGGATGGATGATGG - Intronic
936325581 2:111502513-111502535 CTGGATGGATGGATGGTAGATGG - Intergenic
937207231 2:120244613-120244635 ATGGATGGATGGATGGATGAGGG - Intronic
937675487 2:124585434-124585456 CAGGAAGAATGGATGGATCCAGG + Intronic
938096980 2:128470741-128470763 CTGTAGGACTGGATGCACCATGG - Intergenic
938108034 2:128546613-128546635 ATGGATGCATGGATGGATAATGG - Intergenic
938108073 2:128546804-128546826 ATGGATGGATGGATGGAGAATGG - Intergenic
938108109 2:128546969-128546991 ATGGATGCATGGATGGATAATGG - Intergenic
938108119 2:128547012-128547034 ATGGATGAATGGGTGGATAATGG - Intergenic
938169566 2:129062963-129062985 ATGGATGGATGGATGGATGATGG - Intergenic
939203493 2:139069634-139069656 CTAGATCAATGGAAGGACAAAGG + Intergenic
939237271 2:139512219-139512241 ATGGATGAATGGATAGAGGAGGG - Intergenic
942764881 2:179443318-179443340 CTGGAGGAATGGCTGGAGCCTGG + Exonic
943064322 2:183070859-183070881 CTGGAGGCATGGATGGGCAAGGG + Intergenic
944115735 2:196184417-196184439 ATGGATGAAAGAATGGACAAAGG + Intergenic
944472259 2:200066582-200066604 CTTGATTAATGGCTGCACCAAGG - Intergenic
946007032 2:216533991-216534013 CTGGATGAAAGCAAGAACCAAGG + Intronic
946187210 2:217987874-217987896 GTGGGTGAATGGATGGATGAGGG + Intronic
947233680 2:227918168-227918190 ATGGATGGATGGATGGATGATGG - Intronic
948087070 2:235259749-235259771 CTGAATGAATGAATGGACCCAGG - Intergenic
948237831 2:236403599-236403621 CTGGATGAATAGGTGTAACATGG + Intronic
948818697 2:240527354-240527376 TTGGATGAATGGATGTTGCATGG + Intronic
948818715 2:240527453-240527475 CTGGATGAATGGATGTTCCATGG + Intronic
948838171 2:240636301-240636323 CTGGACGCATGCATGGGCCAGGG - Intergenic
949065795 2:241989759-241989781 GTGGATGGATGGATGGATAATGG - Intergenic
949065798 2:241989774-241989796 ATGGATGAATGGATGGTGGATGG - Intergenic
949065854 2:241990011-241990033 ATGGATGGATGGATGGATGATGG - Intergenic
1168984480 20:2036424-2036446 GTAGATGAATGGATGGACAGTGG + Intergenic
1168984489 20:2036484-2036506 GTAGATGAATGGATGGACAGTGG + Intergenic
1168984499 20:2036544-2036566 GTAGATGAATGGATGGACAGTGG + Intergenic
1168984509 20:2036604-2036626 GTAGATGAATGGATGGACAGTGG + Intergenic
1170095844 20:12645270-12645292 CTGGATGAATGGATGAAAGTAGG + Intergenic
1170361177 20:15548084-15548106 ATGGATGAATGGATGGAGGAAGG - Intronic
1171568188 20:26215575-26215597 AGTGATGAATGGATGGAGCAAGG + Intergenic
1172184908 20:33025436-33025458 ATGGATGAATGAATGGATGATGG - Intergenic
1172203981 20:33148922-33148944 ATGGATGGATGGATGGATGATGG + Intergenic
1172208542 20:33181637-33181659 ATGCATGAATGGATAGATCAGGG - Intergenic
1172544655 20:35750278-35750300 TTGGATGAATGGATGGACAAAGG - Intergenic
1172783316 20:37450184-37450206 ATGGATGAATGGATGGACAAAGG - Intergenic
1172919510 20:38469413-38469435 ATGGATGGATGGATGGATGAGGG - Intergenic
1173871498 20:46344890-46344912 ATGGATGAATGGATGGTAGATGG - Intergenic
1173871501 20:46344909-46344931 ATGGATGGATGGATGGATGATGG - Intergenic
1174577288 20:51545573-51545595 ATGGATGCATGGATGGAAGATGG + Intronic
1174577307 20:51545662-51545684 ATGGATGCATGGATGGAAGATGG + Intronic
1174577323 20:51545728-51545750 ATGGAAGAATGGATGGATGATGG + Intronic
1174746942 20:53072906-53072928 AGGGATGAATGGATGGATGAAGG - Intronic
1174747037 20:53073293-53073315 ATGGATGGATGGATGGATGAAGG - Intronic
1175165282 20:57039176-57039198 TTGGATGGATGGATGGATGATGG + Intergenic
1175165322 20:57039411-57039433 ATGGATGGATGGATGGATGATGG + Intergenic
1175332654 20:58175914-58175936 CTGGGTGACGGGATGGACAAGGG + Intergenic
1175493216 20:59393271-59393293 AAGGATGAATGGATGGATGAAGG - Intergenic
1175687942 20:61045036-61045058 ATGGATGGATGGATGGTCAATGG - Intergenic
1175754107 20:61518461-61518483 AAGGATGGATGGATGGACGATGG - Intronic
1175754151 20:61518765-61518787 ATGGATGAAAGGATGGATGATGG - Intronic
1175754158 20:61518807-61518829 ATGGATTAATGGATGGATGATGG - Intronic
1175754161 20:61518826-61518848 GTGGATGAATGGATGAATGATGG - Intronic
1175754183 20:61518980-61519002 ATGGATGAATGGATGGATGAAGG - Intronic
1175772631 20:61633182-61633204 ATGGATGAATGGATGGAGGATGG - Intronic
1175779195 20:61671645-61671667 ATGGGTGAATGGATGGATAATGG + Intronic
1175798470 20:61787095-61787117 ATGGATGGATGGATGGATGATGG - Intronic
1175817381 20:61890398-61890420 GTGGATGGATGGATGGATGATGG + Intronic
1176047158 20:63098773-63098795 GTGAATGCATGGATGGATCATGG + Intergenic
1176047174 20:63098894-63098916 GTGAATGCATGGATGGAACATGG + Intergenic
1176047190 20:63099015-63099037 GTGAATGCATGGATGGATCATGG + Intergenic
1177250969 21:18590434-18590456 CTGGGAGAATGACTGGACCAGGG - Intergenic
1177617468 21:23541771-23541793 CTGAATGACTGGATGAATCAGGG - Intergenic
1178294520 21:31397914-31397936 CTTGTAGAATGGATGAACCATGG + Intronic
1178304392 21:31479385-31479407 ATGGATGGATGGATGGACGGAGG + Intronic
1178666274 21:34549801-34549823 ATGGATGGATGGATGGATGATGG - Intronic
1178689667 21:34740568-34740590 ATGGATGGATGGATGGACGATGG - Intergenic
1178907857 21:36651160-36651182 ATGGATGGATGGATGGACATAGG - Intergenic
1179006741 21:37521939-37521961 CTGAAAGAATGGATGGAGGAGGG + Intergenic
1179017465 21:37605653-37605675 ATGGATGGATGGATGGATGAAGG - Intergenic
1179130296 21:38630358-38630380 GTGGCTGAATGGATGGAACCTGG - Intronic
1179474765 21:41636110-41636132 GTGGATGAATGGATGGATGATGG - Intergenic
1179549143 21:42132333-42132355 GTGGATGGATGGATGAACAATGG - Intronic
1179568549 21:42264386-42264408 ATGGATGGATGGATGGACAGAGG - Intronic
1179623649 21:42634720-42634742 GTGGATGAATAGATGGACAATGG - Intergenic
1179623662 21:42634834-42634856 GTGGATGAAAAGATGGACAATGG - Intergenic
1179623676 21:42634944-42634966 GTGGATGAATAGATGGACAATGG - Intergenic
1179623690 21:42635050-42635072 GTGGATGAATAGATGGACAATGG - Intergenic
1179623705 21:42635164-42635186 GTGGATGAACAGATGGACAATGG - Intergenic
1179623720 21:42635278-42635300 GTGGATGAAAAGATGGACAATGG - Intergenic
1179623732 21:42635384-42635406 GTGGATGAATAGATGGACAATGG - Intergenic
1179623744 21:42635490-42635512 GTGGATGAAAAGATGGACAATGG - Intergenic
1179623759 21:42635604-42635626 GTGGATGAATAGATGGACAATGG - Intergenic
1180024957 21:45155819-45155841 GTGGATGGATGGATGGATGATGG - Intronic
1180025082 21:45156292-45156314 GTGGATGGATGGATGGATGATGG - Intronic
1180025105 21:45156380-45156402 ATGGATGGATGGATGGATGATGG - Intronic
1181483981 22:23219069-23219091 ATGGATGGATGGATGGACGGAGG + Intronic
1181877093 22:25948174-25948196 ACGGATGGATGGATGGACAATGG - Intronic
1181905503 22:26192029-26192051 ATTGATGAATGGATGGACAGGGG - Intronic
1182010453 22:26996462-26996484 ATGGATGGATGGATGGACTGAGG - Intergenic
1182019777 22:27071669-27071691 AGGGTTGAAGGGATGGACCATGG + Intergenic
1182039081 22:27222380-27222402 ATGGGTGAATGGATGGATGATGG + Intergenic
1182048503 22:27295734-27295756 ATGGATGGATGGATGGATAATGG + Intergenic
1182052766 22:27325622-27325644 GTGGATGGATGGATGGAAGATGG + Intergenic
1182072018 22:27470361-27470383 GTGGATGGATGGATGGATGATGG + Intergenic
1182099733 22:27649414-27649436 ATGGATGGATGGATGGATGATGG + Intergenic
1182155836 22:28072297-28072319 CTGGATGAGTGGATGAGCAAGGG - Intronic
1182512290 22:30827980-30828002 TTGGTTGAATGGATGGTCAAGGG + Intronic
1182862079 22:33568868-33568890 ATGGATGGATGGATGGATGATGG + Intronic
1183100052 22:35578396-35578418 CTGGATGGATGGATGGTGGATGG + Intergenic
1183106491 22:35618796-35618818 ATGGATGAATGGAGGGATGATGG - Intronic
1183303932 22:37071974-37071996 ATGGATGGATGGATGGATGATGG + Intronic
1183303966 22:37072144-37072166 ATGGGTGAATGGATGGATGATGG + Intronic
1183303979 22:37072216-37072238 ATGGATGGATGGATGGATGATGG + Intronic
1183303999 22:37072322-37072344 ATGGATGAATGGATGGATGATGG + Intronic
1183304003 22:37072341-37072363 ATGGATGGATGGATGGATGATGG + Intronic
1183304027 22:37072467-37072489 ATGGATGGATGGATGGATGATGG + Intronic
1183304035 22:37072523-37072545 ATGGATGAATGGATGGATGATGG + Intronic
1183304038 22:37072542-37072564 ATGGATGAATGGATGGATGATGG + Intronic
1183304042 22:37072561-37072583 ATGGATGGATGGATGGATGATGG + Intronic
1183304049 22:37072595-37072617 ATGGATGGATGGATGGATGATGG + Intronic
1183304090 22:37072798-37072820 ATGGATGGATGGATGGATGATGG + Intronic
1183304098 22:37072840-37072862 ATGGATGGATGGATGGATGATGG + Intronic
1183304128 22:37073010-37073032 ATGGATGGATGGATGGATGATGG + Intronic
1183321929 22:37170114-37170136 ATGGATGGATGGATGGATGAAGG + Intronic
1183600024 22:38834597-38834619 ATGGATGGATGGATGGATGATGG - Intronic
1184293097 22:43508664-43508686 ATGGATGAATGCATGGATGATGG - Intergenic
1184321289 22:43743991-43744013 ATGGATGAATGAATGGATGAAGG + Intronic
1184444555 22:44539712-44539734 GTGGATGGATGGATGGATGATGG + Intergenic
1184460202 22:44633529-44633551 CTGGATGAATGCATGGAAAATGG + Intergenic
1184930765 22:47679633-47679655 ATGGATGGATGGATGGATGATGG - Intergenic
1184930769 22:47679652-47679674 ATGGATGGATGGATGGATGATGG - Intergenic
1184953430 22:47862552-47862574 GAGGAAGAATGGATGGAGCAGGG + Intergenic
1184996775 22:48212978-48213000 ATGGATGGATGGATGGATGATGG - Intergenic
1185053514 22:48566062-48566084 ATGGATGGATGGATGGATGATGG + Intronic
1185053562 22:48566309-48566331 ATAGATGGATGGATGGACGATGG + Intronic
1185076745 22:48687265-48687287 GTGGATGAATGGATGGTGGACGG + Intronic
1185108524 22:48887694-48887716 GTGGATGAATGGATGGATGGTGG - Intergenic
1185154328 22:49184009-49184031 CTGGCTGCCTGGATGCACCATGG - Intergenic
1185165589 22:49260430-49260452 ATGGATGAATGGATGGATGATGG - Intergenic
1185193499 22:49453471-49453493 AAGGATGGATGGATGGAGCATGG + Intronic
1185196815 22:49476870-49476892 ATGGATGGATGGATGGATGATGG + Intronic
1185196996 22:49477630-49477652 ATGGATGGATGGATGGATGATGG + Intronic
949845201 3:8362643-8362665 CTAGATGGATGGATGGAGGATGG + Intergenic
949845357 3:8364686-8364708 ATGAATGAATGGATGGATGAAGG - Intergenic
950744658 3:15077564-15077586 CTGTATGTCTGGATGGACAAAGG + Intronic
951057357 3:18163238-18163260 CTGGCTGGAAGGATGTACCAAGG + Intronic
951707701 3:25559806-25559828 GTGGATCAATGGATGGAAAATGG + Intronic
952307669 3:32160308-32160330 ATGGGTGAATGGATGGATGATGG + Intronic
952307686 3:32160367-32160389 ATGGATGGATGGATGGATTATGG + Intronic
952307703 3:32160427-32160449 ATGGGTGAATGGATGGATGATGG + Intronic
952307733 3:32160533-32160555 ATGGGTGAATGGATGGATGATGG + Intronic
954197020 3:49002958-49002980 CTGGAGAGATGGATGGAGCAGGG - Intronic
954886043 3:53874815-53874837 CAGAATGAATGGATGGAAGAAGG + Intronic
955385357 3:58474932-58474954 ATGGACGAATGGATGGATGAAGG - Intergenic
955531750 3:59880301-59880323 CTGGATGAAGGGAAGGAGCCAGG - Intronic
955645153 3:61129434-61129456 ATGGATGAATAGTTGGAACATGG + Intronic
956069754 3:65435488-65435510 ATGGATGGATGGATGGAAGATGG + Intronic
956972095 3:74537970-74537992 ATGGATGAATGAATGACCCATGG + Intergenic
958064872 3:88530312-88530334 CTAGATAAATGGATGAACAAGGG - Intergenic
959230852 3:103648972-103648994 GTGAATGAATGAATGGACCTGGG - Intergenic
959236967 3:103736908-103736930 CTGGAAGAATGAATGGTTCAGGG + Intergenic
960218270 3:115070575-115070597 CTGGAAGAATGGATTTACCATGG + Intronic
960367728 3:116794155-116794177 ATGGATGGATGGATGGATGAAGG + Intronic
962474580 3:135743931-135743953 ATGGATGGATGGATGAATCATGG + Intergenic
962804076 3:138914887-138914909 ATGGATGAATGGATGGATGAAGG + Intergenic
962835839 3:139187715-139187737 CTTCATGAATGGATGGATCCAGG + Intronic
962844601 3:139263459-139263481 CTGGATTGAGGGCTGGACCATGG - Intronic
963059838 3:141216458-141216480 GTAGATGAATGGATGGATGAGGG + Intergenic
964440320 3:156701849-156701871 CTGGATGGATGGGTGGATCCAGG - Intronic
965356563 3:167681487-167681509 ATGAATGAATGGATGGATCAGGG + Intergenic
966409189 3:179631158-179631180 CAGGAGCAATGGAAGGACCATGG + Intergenic
966567465 3:181398862-181398884 ATGGATGAATGGGTGGATGATGG + Intergenic
966916943 3:184590033-184590055 ATGGATGAATGGATAGACAATGG + Intronic
967433734 3:189419909-189419931 CAGGATGACTGGATAGAACATGG - Intergenic
968443613 4:636852-636874 CTGGATGGCTGGATGCCCCAGGG - Intronic
968598371 4:1496920-1496942 ATGGATGGATGGATGGATAATGG + Intergenic
968598424 4:1497280-1497302 ATGGATGGATGGATGGATAATGG + Intergenic
968931215 4:3580482-3580504 ATGGATGGATGGATGGAGGATGG - Intronic
968935820 4:3609895-3609917 ATGGATGAGTGGATGGAGGATGG - Intergenic
968946196 4:3665706-3665728 ATGGATGGATGGGTGGATCAAGG - Intergenic
969017444 4:4113342-4113364 CAGGATGGTTGGCTGGACCAAGG + Intergenic
969031318 4:4217146-4217168 CTGGATGAATGGATGAACACAGG - Intronic
969424797 4:7117963-7117985 ATGGATGAATGGATGGATGGAGG + Intergenic
969424929 4:7118593-7118615 GTGGATGGATGGATGGATGATGG + Intergenic
969465126 4:7351799-7351821 ATGGATGAATGGATGGGTGATGG - Intronic
969485467 4:7470222-7470244 ATGGATGGGTGGATGGACCGAGG - Intronic
969499509 4:7544176-7544198 ATGGATGAAGGGATGGAGGATGG - Intronic
969510410 4:7614441-7614463 ATGGGTGAATGGATGGATTATGG - Intronic
969510432 4:7614556-7614578 ATGGATGGATGGATGGACAGTGG - Intronic
969612280 4:8234121-8234143 ATGGATAAATGGATGGATGATGG - Intronic
969612291 4:8234179-8234201 ATGGATGAATGGATGGATGATGG - Intronic
969612300 4:8234220-8234242 ATGGGTGAATGGATGGATGATGG - Intronic
970130598 4:12865693-12865715 CTGAATGGATGGATCCACCAAGG - Intergenic
971127399 4:23769385-23769407 ATGGATGGATGGATGGATGATGG - Intronic
974628728 4:64456528-64456550 ATGGATGATTGGATGGGCAAAGG + Intergenic
976075547 4:81295227-81295249 ATGGATGGATGGATGGATGATGG + Intergenic
979600887 4:122585759-122585781 CTAGATGGATGGATGGAGCATGG + Intergenic
979971000 4:127135177-127135199 ATGGATGAATGAATGGATGAAGG + Intergenic
980504724 4:133702031-133702053 ATGGAAGAATGGCTGGATCATGG + Intergenic
981603806 4:146521809-146521831 CTGCATGTCTGGAGGGACCAAGG - Exonic
982841179 4:160188296-160188318 ATCGATGAATGAATGGACCAAGG + Intergenic
983622127 4:169772920-169772942 CTGAATGAATGGATGGATGAAGG - Intergenic
983873398 4:172848495-172848517 CTGGATGAATGAATAGACAGGGG + Intronic
984691876 4:182735351-182735373 CAGCATGAATGAATGGACGAAGG - Intronic
984756892 4:183332936-183332958 GTGGATGGATGGATGGATGATGG - Intergenic
985111514 4:186551559-186551581 ATGGATGGATGGACGGACGATGG + Intronic
985179236 4:187238485-187238507 CTGGATGAATGGAGGGTGTAGGG - Intergenic
985547612 5:517901-517923 ATGGATGGATGGATGGATGATGG - Intronic
985709173 5:1418704-1418726 ATGGATGGATGGATGGATGATGG - Intronic
985709183 5:1418739-1418761 ATGGATGGATGGATGGATGATGG - Intronic
985709207 5:1418855-1418877 ATGGATGGATGGATGGATAATGG - Intronic
985709258 5:1419117-1419139 ATGGATGAATGGATGATGCATGG - Intronic
985848810 5:2373719-2373741 CTGGATGAATGAATGAATGAGGG + Intergenic
985941809 5:3142308-3142330 CTTGATGAATGGAGGCTCCAGGG + Intergenic
986072880 5:4304434-4304456 CTGGATGAATAGATGGATGATGG - Intergenic
986758379 5:10858081-10858103 CTGGATGAATGGATCGTGCCAGG - Intergenic
992013029 5:72549593-72549615 CTGGATGGATGGATGGATGGAGG + Intergenic
992462086 5:76970534-76970556 ATGGATGGATGGATGGATGACGG + Intronic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
994169190 5:96640303-96640325 ATGGAAGGATGGATGGACAAAGG + Intronic
997286134 5:132679981-132680003 ATGAATGAATGGGTTGACCAAGG - Intronic
997906830 5:137825672-137825694 ATGGATGAATGAAAGGACCCTGG + Intergenic
999429580 5:151514624-151514646 CTGGAAGAACGGATGGACTCAGG - Intronic
999445012 5:151632319-151632341 ATGGATGCATGGATGGATAATGG + Intergenic
999665598 5:153909952-153909974 CTGGAAGAATTGATGGCTCATGG + Intergenic
999746741 5:154598182-154598204 ATGGATGAATGGATGGATGATGG + Intergenic
999844744 5:155466902-155466924 CTGGCTGATTGTATGGACAAAGG - Intergenic
1000948381 5:167450047-167450069 ATGGATGGATGGATGGATGATGG + Intronic
1001435457 5:171695939-171695961 ATGGATGGATGGATGGATGATGG + Intergenic
1001543443 5:172555151-172555173 CTGGATGAATGAATGGAGGAGGG - Intergenic
1001646322 5:173284682-173284704 GTGGATGATTGGATGGATGAGGG - Intergenic
1001646349 5:173284805-173284827 GTGGATGATTGGATGGATGAGGG - Intergenic
1001646408 5:173285079-173285101 GTGGATGACTGGATGGATGAGGG - Intergenic
1001701722 5:173711651-173711673 ATGGGTGAATGGATGGAAGAGGG + Intergenic
1001701737 5:173711741-173711763 ATGGATGGATGGATGGATGATGG + Intergenic
1001751435 5:174134546-174134568 ATGGATGGATGGATGGATGATGG - Intronic
1001751445 5:174134588-174134610 ATGGGTGAATGGATGGATGATGG - Intronic
1001751459 5:174134668-174134690 ATGGATGGATGGATGGATAATGG - Intronic
1001751483 5:174134820-174134842 ATGGATGGATGGATGGATGATGG - Intronic
1001865670 5:175102964-175102986 CTGGATGGATGGATGAATGATGG + Intergenic
1002067640 5:176660128-176660150 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002067648 5:176660155-176660177 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002067656 5:176660182-176660204 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002303300 5:178269547-178269569 ATGGATGGATGGATGGATGATGG - Intronic
1002439099 5:179255001-179255023 ATGGATGGATGGATGGATGATGG + Intronic
1002565850 5:180112831-180112853 GAGGATGGATGGAGGGACCAAGG + Intronic
1003520586 6:6855434-6855456 TTGAATGAATGGATGGAAAATGG - Intergenic
1003731511 6:8829804-8829826 CTGTAGGACTGGATGGACAAAGG + Intergenic
1004344514 6:14836389-14836411 ATGGATTGATGGATGGATCAAGG - Intergenic
1004585908 6:17000129-17000151 CTGGTTGGATGGATGGATGAAGG - Intergenic
1006706141 6:36023158-36023180 ATGGATGGATGGATGGATAAGGG - Intronic
1006737427 6:36284508-36284530 TTGGATGGATGGATGGATAAAGG - Intronic
1008422135 6:51313640-51313662 ATGGATGAATGGATGGATGATGG - Intergenic
1008482704 6:52002960-52002982 TTTGATGAATGGATGGATGAAGG - Intronic
1008483859 6:52014482-52014504 CTGGATAGATGGATGGATCATGG + Intronic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1008483883 6:52014618-52014640 CTGGATAAATGGATGGATCATGG + Intronic
1008483911 6:52014771-52014793 CTGGATAGATGGATGGATCATGG + Intronic
1008741163 6:54610117-54610139 ATGAATGAATGGAGGGATCAAGG - Intergenic
1010651240 6:78457631-78457653 TTGGATGAATAAATGGAGCAGGG - Intergenic
1010816733 6:80366679-80366701 ATGGATGAATGGATGGATAGAGG - Intergenic
1011524736 6:88252281-88252303 TTGGGTGAATGGATGGAAGAAGG + Intergenic
1012397079 6:98810934-98810956 ATGGATGAATGGATGGCTGATGG + Intergenic
1012456594 6:99413442-99413464 ATGGATGGATGGATGGATCATGG - Intronic
1013048335 6:106509736-106509758 GTGGCTGAATGGAAGGAGCATGG + Intergenic
1014505156 6:122246928-122246950 TGGGCTGAATGGATGGAACAAGG - Intergenic
1014791196 6:125674360-125674382 ATGAATCAATGGAAGGACCAAGG - Intergenic
1015141544 6:129939856-129939878 ATGAATGAATGGATGGATGATGG - Intergenic
1015164150 6:130184752-130184774 ATGGATGAATGGATGGAAGATGG - Intronic
1016027627 6:139303826-139303848 CTGGATGATTGGCTGCAACATGG - Intergenic
1016058071 6:139599827-139599849 TTAGATGAATGGATGGACAGAGG - Intergenic
1017053883 6:150420512-150420534 CTGAATGAATGTATGGAGCAGGG - Intergenic
1017659036 6:156656056-156656078 ATGAATGAATGGATGGATGAGGG - Intergenic
1017821766 6:158054062-158054084 ATGGCTGAATGGATGGATAATGG - Intronic
1018172424 6:161153061-161153083 CTGGGTGCCTGGATGGCCCATGG - Intronic
1018239710 6:161761319-161761341 GTGGATGGATGGATGGATGATGG + Intronic
1018625141 6:165770906-165770928 CAGGATGAATGGGGGGACAATGG - Intronic
1018853066 6:167655061-167655083 ATGGATGGATGGATGGATGATGG + Intergenic
1018853166 6:167655635-167655657 ATGGATGAATGGATGGATGATGG + Intergenic
1019345600 7:528736-528758 GTGGATGAATGGATAGAAGATGG + Intergenic
1019457260 7:1136849-1136871 GAGGATTTATGGATGGACCAAGG - Intronic
1019503692 7:1379584-1379606 ATGGATGGATGGATGGATGATGG + Intergenic
1019510810 7:1416372-1416394 ATGGATGGATGGATGGAGGATGG + Intergenic
1019567252 7:1690425-1690447 ATGGGTGAATGGATGGATGAAGG + Intronic
1019567286 7:1690608-1690630 ATGGATAAATGGATGGATGAAGG + Intronic
1019567328 7:1690785-1690807 ATGGGTGAATGGATGGATGAAGG + Intronic
1019704598 7:2491469-2491491 ATGGATGGATGGATGGATGATGG - Intergenic
1019704646 7:2491698-2491720 ATGGATGGATGGATGGACAGAGG - Intergenic
1019704666 7:2491781-2491803 ATGGATGGATGGATGGACAGAGG - Intergenic
1019704731 7:2492080-2492102 ATGGATGGATGGATGGACAGAGG - Intergenic
1019776027 7:2912715-2912737 ATGGATGGATGGATGGATAAGGG - Intronic
1019914668 7:4125069-4125091 ATGGATGGATGGATGGATGATGG + Intronic
1019914725 7:4125361-4125383 ATGGATGAATGGATGGGTGATGG + Intronic
1022131706 7:27410782-27410804 TTGGATGAATGGATGAACACTGG + Intergenic
1022274733 7:28844112-28844134 CTGGATGAATGGCTCTCCCAAGG - Intergenic
1022477237 7:30719598-30719620 ATGGATGGATGGATGGATGATGG - Intronic
1023178795 7:37459899-37459921 TTGGCTGCATGGAGGGACCAGGG - Intergenic
1024047712 7:45596455-45596477 CTGGGTGGATGGATGTACCCTGG + Intronic
1026161169 7:67870061-67870083 ATGGATGAATGGATGGATGGAGG + Intergenic
1026203537 7:68235736-68235758 ATGGATGAATGGATGGAAGGTGG + Intergenic
1026203561 7:68235896-68235918 ATGAATGAATGGATGGATGAAGG + Intergenic
1026275208 7:68870337-68870359 CTGGATGGATGGATGGATGATGG + Intergenic
1026275212 7:68870368-68870390 ATAGATGAATGGATGGATGATGG + Intergenic
1026319638 7:69257610-69257632 ATGGATGGATGGATGGATGACGG + Intergenic
1026531329 7:71199802-71199824 TTGGATGGATGGATGGATGATGG - Intronic
1026681752 7:72472290-72472312 GTGGATGAATGCATGGTCAATGG + Intergenic
1027163760 7:75820665-75820687 GTGGATGGATGGATGGATGATGG - Intronic
1027888947 7:83946314-83946336 CAGGATGAAAGGATTGACAATGG - Intergenic
1029300379 7:99578320-99578342 CTGAATGAATGGATGAATGAAGG - Intronic
1029409315 7:100398579-100398601 CTGGGTGAATGGATAGAGAAGGG - Intronic
1029599728 7:101556647-101556669 ATGGATGGATGGATGGATGATGG + Intronic
1029604861 7:101592455-101592477 ATGGATGGATGGATGGATGATGG - Intergenic
1029815032 7:103084889-103084911 CTGGATCAGTCGAGGGACCATGG + Intronic
1029924474 7:104301159-104301181 CAGGAGCAATGGATGGAACATGG + Intergenic
1030075635 7:105733929-105733951 ATGGATGGATGGATGGATGATGG - Intronic
1030350236 7:108476742-108476764 ATGGATGAATGAATGGATAAAGG + Intronic
1031888486 7:127265849-127265871 ATGGATGCATGGATGGATGATGG + Intergenic
1032463453 7:132128508-132128530 CAGGATGAATGGATGAGCAAGGG + Exonic
1032645530 7:133819486-133819508 CTGGATGAATGCATGTTGCATGG + Intronic
1032680747 7:134180285-134180307 ATGGATGGATGGATGGACAGAGG - Intronic
1032725165 7:134584346-134584368 ATGGATGAATGGATGGATGGAGG + Intergenic
1032866343 7:135929006-135929028 CTGTTTGAATGGATTGACCTTGG - Exonic
1033288329 7:140061363-140061385 CTGAATGACTGTATGGATCAAGG + Intronic
1035120315 7:156561166-156561188 CTGGATGGATGGCTGGCCCCTGG - Intergenic
1035278964 7:157765505-157765527 GTGGGTGAATGGATGGAGGAAGG - Intronic
1035279089 7:157766047-157766069 ATGGATGGATGGATGGAGGAAGG - Intronic
1035318768 7:158014690-158014712 ATGGATGAATGGAGGGACAGAGG - Intronic
1035576426 8:709824-709846 CTGTATGCATGGATGGATGATGG - Intronic
1035989120 8:4468569-4468591 GTGGCTGAATGGATGAATCAAGG - Intronic
1036565709 8:9936223-9936245 GTGGATGCATGGATAAACCATGG - Intergenic
1037227223 8:16606946-16606968 ATGGATGAATCAATGAACCATGG - Intergenic
1037444949 8:18956090-18956112 CTGAATGAATGGAAGGAAGAAGG + Intronic
1037921285 8:22807985-22808007 ATGGATGAATGGATAGACATTGG - Intronic
1037921302 8:22808083-22808105 CTGAATGAATGGATGGATAGAGG - Intronic
1038120468 8:24608692-24608714 ATGAATGAATGAATGGACGAAGG - Intergenic
1038440769 8:27569564-27569586 ATGGATGGATGGATGGATGAAGG + Intergenic
1038440910 8:27570180-27570202 ATGGATGGATGGATGGATGAAGG + Intergenic
1038440913 8:27570192-27570214 ATGGATGAAGGGATGGATGAAGG + Intergenic
1038440918 8:27570216-27570238 ATGGATGCATGGATGGATGAAGG + Intergenic
1040584521 8:48726826-48726848 GTGGATGCATGGATGGACAATGG - Intronic
1041010257 8:53534936-53534958 ATGGATGGATGGATGGATGATGG + Intergenic
1042215343 8:66425437-66425459 ATGGATGGATGGATGGATGAAGG + Intergenic
1043136888 8:76539089-76539111 CTTTATGAATGGCTGGATCAAGG + Intergenic
1044666827 8:94640806-94640828 CTGGATGAATGGAGAGGCGAGGG - Intergenic
1045024077 8:98070092-98070114 CTAGATGGATGGATGGACCTGGG + Intronic
1045628598 8:104087387-104087409 ATGGATGGATGGATGGACAAGGG + Intronic
1045857360 8:106780067-106780089 CTGGAAGAATGAAGGGACAAGGG - Intergenic
1046112171 8:109738478-109738500 ATGGATGGATGGATGGATGAGGG - Intergenic
1047253320 8:123197015-123197037 CTGACAGAATGGTTGGACCAGGG - Intronic
1047306897 8:123659744-123659766 ATGGATGGATGGATGGATGATGG - Intergenic
1047306906 8:123659783-123659805 ATGGATGAATGGATAGATGATGG - Intergenic
1047306910 8:123659814-123659836 CTGGATGAATGGATGCTGGATGG - Intergenic
1047333774 8:123917148-123917170 ACGGATGAATGGATGGATAAAGG - Intronic
1047344529 8:124014245-124014267 TAGGAAGAATGAATGGACCAGGG + Intronic
1047929707 8:129714396-129714418 TTGGATGAATGGATGGACGGAGG - Intergenic
1048176773 8:132159846-132159868 ATGGATGAATGGGTGGATGATGG - Intronic
1048187873 8:132260877-132260899 TTGGATGGATGGATGGATGATGG - Intronic
1048254903 8:132898336-132898358 CTGGCTGAAGGGCTGGGCCATGG - Intronic
1048297048 8:133222117-133222139 ATGGATGGATGGATGGAGGATGG + Intronic
1048989246 8:139751707-139751729 CTGGATGGATGGATGGTAGATGG - Intronic
1049042181 8:140120835-140120857 ATGGATGGATGGATGGATGATGG - Intronic
1049348313 8:142150734-142150756 ATGGATGGATGGATGGACGATGG + Intergenic
1049350926 8:142164221-142164243 ATGGATGGATGGATGGATGAAGG + Intergenic
1049364289 8:142229240-142229262 ATGGATGAATGGATGGATGGTGG + Intronic
1049474876 8:142792436-142792458 GTGGATGGATGGATGGATGACGG - Intergenic
1049474933 8:142792763-142792785 GAGGATGGATGGATGGAGCATGG - Intergenic
1049480644 8:142820908-142820930 ATGAATGAATGGCTGAACCAAGG - Intergenic
1050373467 9:4946478-4946500 ATGGATTAATGGATGGACAGAGG - Intergenic
1050458749 9:5858815-5858837 CTGGAAGGATGGATGGATGATGG + Intergenic
1051769785 9:20564865-20564887 GTGGAAGAATGGATGGCTCAAGG - Intronic
1052304679 9:26993783-26993805 CTAGAGGTATGGATGGAGCAAGG - Exonic
1054454248 9:65421401-65421423 ATGGATGAGTGGATGGATAATGG + Intergenic
1054454363 9:65421971-65421993 GTGGATGAGTGGATGGAAGATGG + Intergenic
1054458884 9:65451342-65451364 ATGGATGGATGGATGGATGATGG + Intergenic
1054458905 9:65451432-65451454 ATGGATGGATGGATGGAGGATGG + Intergenic
1054458943 9:65451600-65451622 ATGGATGGATGGATGGAGGATGG + Intergenic
1054919647 9:70529275-70529297 CTTTGTGTATGGATGGACCACGG - Exonic
1055557206 9:77487164-77487186 CTGGATGAAGGGATGATTCATGG + Intronic
1056135482 9:83625918-83625940 ATGGATGGATGGATGGAAGACGG + Intronic
1056621018 9:88214627-88214649 ATGGATGAATGGATAAACTATGG - Intergenic
1057008701 9:91583223-91583245 CTGGATGGATGGATGGAGGATGG + Intronic
1057082630 9:92184424-92184446 ATGGATAAATGGATGGATAATGG - Intergenic
1058230883 9:102422898-102422920 CTGGATGGATCGATGGATGATGG - Intergenic
1058941921 9:109821495-109821517 ATGCATGAATGGATACACCATGG - Intronic
1059033498 9:110727599-110727621 CTGGATGGATGCATGGTCCTTGG + Intronic
1059170231 9:112117788-112117810 CTGGTTGAATGGATGGATAAAGG + Intronic
1059322030 9:113477357-113477379 ATGGATGACGGGCTGGACCAGGG + Intronic
1059416404 9:114165340-114165362 ATGGATGGATGGATGGATGATGG - Intronic
1060037185 9:120265514-120265536 ATGGATGGATGGATGGAAAATGG + Intergenic
1061256674 9:129457476-129457498 ATGGATGGATGGATGGATGATGG + Intergenic
1061316836 9:129801684-129801706 CTGAATGAAAGAATGGACCTCGG + Intergenic
1061417446 9:130454783-130454805 ATGGATGGATGGATGGATGATGG - Intronic
1061417458 9:130454829-130454851 ATGGATGGATGGATGGATGATGG - Intronic
1061417487 9:130454972-130454994 ATGGATGAATGGACGGAGGATGG - Intronic
1061417499 9:130455029-130455051 ATGGATGAATGGATGGATGATGG - Intronic
1061417502 9:130455048-130455070 ATGGATGGATGGATGGATGATGG - Intronic
1061417516 9:130455132-130455154 ATGGATGGATGGATGGATGATGG - Intronic
1061417522 9:130455169-130455191 ATGGATGAATGGATGATGCATGG - Intronic
1061545186 9:131300242-131300264 ATGGATGAATGCAGGTACCAGGG - Intronic
1061783080 9:133007212-133007234 ATGGGTGGATGGATGGACAATGG + Intergenic
1061950616 9:133933902-133933924 GTGGATGGATGGATGGATGATGG + Intronic
1061980952 9:134103380-134103402 CTGGATGGATGGATGGTGGATGG - Intergenic
1061981006 9:134103630-134103652 CTGGATGGATGGATGGATGGTGG - Intergenic
1061981017 9:134103679-134103701 CTGGATGAATGGACGGATGCTGG - Intergenic
1062089793 9:134669351-134669373 GTAGATGAATGGATGGAAGAAGG - Intronic
1062092317 9:134684933-134684955 ATGGATGAATGGATGGTGGATGG - Intronic
1062092355 9:134685099-134685121 ATGGATGAATGGATGGATGGTGG - Intronic
1062092400 9:134685305-134685327 ATGGATGAATGGATGGATGGTGG - Intronic
1062092430 9:134685445-134685467 ATGGATGGATGGATGGATGATGG - Intronic
1062092448 9:134685526-134685548 CTGGATGGATGGATGGTGGATGG - Intronic
1062092459 9:134685580-134685602 ATGGATGGATGGATGGAGGATGG - Intronic
1062172226 9:135141240-135141262 ATGGATGGATGGATGGATGATGG + Intergenic
1062205470 9:135334385-135334407 TTGGATAAATGGATGGATGATGG + Intergenic
1062205489 9:135334505-135334527 TTGGATAAATGGATGGATGATGG + Intergenic
1062247737 9:135578117-135578139 ATGGATGAATGGATGGATGCAGG - Intergenic
1062247806 9:135578463-135578485 ATGGATGAATGGATGGATGCAGG - Intergenic
1062247875 9:135578809-135578831 ATGGATGAATGGATGGATGCAGG - Intergenic
1062458522 9:136652778-136652800 ATGAATGAATGAATGAACCATGG + Intergenic
1062520696 9:136956669-136956691 ATGGATGGATGGATGGATGATGG + Intronic
1062520725 9:136956815-136956837 ATGGATAAATGGATGGATGAAGG + Intronic
1062649818 9:137569715-137569737 ATGGATGGATGGATGGATCATGG - Intronic
1185497532 X:566589-566611 ATGGATAAATGGATGGATGATGG + Intergenic
1185546998 X:953845-953867 CTGAATGAATGGATGGATGAGGG - Intergenic
1185547110 X:954450-954472 CTGGATGAATGGATGGATGAGGG - Intergenic
1185611416 X:1395598-1395620 ATGGATGGATGGATGGATGATGG + Intergenic
1185611443 X:1395726-1395748 ATGGATGGATGGATGGATAATGG + Intergenic
1185611447 X:1395745-1395767 ATGGATGGATGGATGGATAATGG + Intergenic
1185611456 X:1395802-1395824 ATGGATGGATGGATGGATAATGG + Intergenic
1185616429 X:1424687-1424709 GTGGATGACTGGATGGATAAAGG - Intronic
1185629963 X:1508678-1508700 ATGGATGGATGGATGGATGATGG - Intronic
1185629975 X:1508838-1508860 ATGGATGAATGGATGGATGGAGG - Intronic
1185630011 X:1509340-1509362 ATGGATGGATGGATGGATGATGG - Intronic
1185630024 X:1509500-1509522 ATGGATGAATGGATGGATGGAGG - Intronic
1185639257 X:1577641-1577663 ATGGATGGATGGATGGATGATGG + Intergenic
1185780599 X:2841432-2841454 ATGGATGGATGGATGGATGATGG + Intronic
1185867814 X:3639149-3639171 GTGGATGGATGGATGGATGAAGG + Intronic
1185867852 X:3639265-3639287 ATGGATGGATGGATGGATGAAGG + Intronic
1185874552 X:3691882-3691904 ATGGATGGATGGATGGACAATGG + Intronic
1186001900 X:5021914-5021936 ATGGATGAATGGATGGAAGATGG - Intergenic
1186002067 X:5023797-5023819 ATGGATGGGTGGATGGATCAGGG - Intergenic
1186055577 X:5646182-5646204 ATGGATGGATGGATGGATGATGG - Intergenic
1186178642 X:6951213-6951235 ATGGATGGATGGATGGATGATGG - Intergenic
1186338992 X:8623013-8623035 CTGGATGGATGGATGGATGATGG + Intronic
1187495846 X:19794845-19794867 CTGAATGAATGGAAGGAGTAAGG - Intronic
1193588097 X:83352494-83352516 CTAGCTGGATGGATGGAACAAGG - Intergenic
1195292633 X:103443944-103443966 ATGGAAGAATGGATGAAGCAGGG - Intergenic
1195618733 X:106932797-106932819 CTGTTTGAATGGCTGGACAAAGG - Intronic
1195640420 X:107168824-107168846 CTGGATAAATGCATAAACCATGG + Intronic
1196266629 X:113656237-113656259 ATGGGTGAATGGATAGACAATGG + Intergenic
1196632176 X:117954414-117954436 ATGGATGGATGGATGGATAAAGG + Intronic
1196650126 X:118159915-118159937 ATGGATGGATGGATGGAGAATGG + Intergenic
1197720090 X:129739171-129739193 CTGGGTGGATGGAGGGACAAGGG - Exonic
1198954521 X:142113260-142113282 ATGGATGAATAGATGGAACACGG - Intergenic
1200781575 Y:7221077-7221099 ATGGATGAATGGATGGATGATGG + Intergenic
1200914528 Y:8559806-8559828 CTGGATGAAGGGAGGCAGCAAGG + Intergenic
1201286823 Y:12386365-12386387 ATAGATGAATGGATGGATGATGG + Intergenic
1201917383 Y:19196693-19196715 ATGGATTAATGGATGGATGATGG + Intergenic
1201917407 Y:19196898-19196920 ATGGATGGATGGATGGATTATGG + Intergenic