ID: 916687779

View in Genome Browser
Species Human (GRCh38)
Location 1:167162764-167162786
Sequence GAAAAGTACTACACGCGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916687779_916687782 -9 Left 916687779 1:167162764-167162786 CCCAGGCGCGTGTAGTACTTTTC No data
Right 916687782 1:167162778-167162800 GTACTTTTCTGTGACGACCTGGG 0: 1
1: 0
2: 1
3: 9
4: 60
916687779_916687789 23 Left 916687779 1:167162764-167162786 CCCAGGCGCGTGTAGTACTTTTC No data
Right 916687789 1:167162810-167162832 TCACGGTTTGGGTGTGAACGCGG 0: 1
1: 0
2: 1
3: 5
4: 62
916687779_916687785 11 Left 916687779 1:167162764-167162786 CCCAGGCGCGTGTAGTACTTTTC No data
Right 916687785 1:167162798-167162820 GGGCCGCCTTCTTCACGGTTTGG 0: 1
1: 0
2: 0
3: 1
4: 59
916687779_916687781 -10 Left 916687779 1:167162764-167162786 CCCAGGCGCGTGTAGTACTTTTC No data
Right 916687781 1:167162777-167162799 AGTACTTTTCTGTGACGACCTGG 0: 1
1: 0
2: 4
3: 3
4: 63
916687779_916687783 6 Left 916687779 1:167162764-167162786 CCCAGGCGCGTGTAGTACTTTTC No data
Right 916687783 1:167162793-167162815 GACCTGGGCCGCCTTCTTCACGG 0: 1
1: 2
2: 4
3: 20
4: 176
916687779_916687786 12 Left 916687779 1:167162764-167162786 CCCAGGCGCGTGTAGTACTTTTC No data
Right 916687786 1:167162799-167162821 GGCCGCCTTCTTCACGGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916687779 Original CRISPR GAAAAGTACTACACGCGCCT GGG (reversed) Intergenic
No off target data available for this crispr