ID: 916694869

View in Genome Browser
Species Human (GRCh38)
Location 1:167223855-167223877
Sequence TGCACCCGATTCCCAAGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916694868_916694869 -3 Left 916694868 1:167223835-167223857 CCTTAAATAGCATATGTTTTTGC 0: 1
1: 0
2: 2
3: 18
4: 303
Right 916694869 1:167223855-167223877 TGCACCCGATTCCCAAGATGTGG 0: 1
1: 0
2: 0
3: 4
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916694869 Original CRISPR TGCACCCGATTCCCAAGATG TGG Intronic
902401114 1:16157232-16157254 TGGACCCGCTTCCCAAGAGTAGG - Intergenic
902575130 1:17372782-17372804 AGCACCCAATTCCCAAGAAGGGG - Intronic
908048535 1:60201033-60201055 TACACCAGTTTCCCAGGATGTGG + Intergenic
909919119 1:81358282-81358304 TGCACCTTATTCACATGATGTGG - Intronic
916694869 1:167223855-167223877 TGCACCCGATTCCCAAGATGTGG + Intronic
924181234 1:241440335-241440357 TGTACCCGATACTCCAGATGGGG + Intergenic
1074789059 10:116868045-116868067 TGCACCCAATACCCCAAATGTGG + Intronic
1077025496 11:438157-438179 TGCACCCCATTCCCCAGGGGAGG - Intronic
1077310883 11:1888610-1888632 TGCACCCTAGTCCCAGGATCTGG + Intronic
1078672215 11:13375819-13375841 TGCACCCCATTTCCCAGATGAGG - Intronic
1078727034 11:13940871-13940893 TGCTTCAGTTTCCCAAGATGAGG + Intergenic
1081610488 11:44559906-44559928 TGAGGCCCATTCCCAAGATGTGG - Intergenic
1081847303 11:46249996-46250018 TGGAACCAATTCCCAAGATTTGG - Intergenic
1084955014 11:72686466-72686488 AGTTCCCGATTCCTAAGATGGGG - Intronic
1095345544 12:41144751-41144773 TGCAACCCATTCCCAGGAGGAGG - Intergenic
1101755140 12:107615630-107615652 TGGACCTGATTCTCAAGAAGTGG - Intronic
1104699234 12:130889069-130889091 TCCACCCCATCCCCAGGATGTGG + Intergenic
1112394415 13:99015599-99015621 TGCAACCCATCCCCAAGGTGTGG + Intronic
1121174773 14:91882858-91882880 TGCACATGATTCCCCAGGTGAGG + Intronic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1125224109 15:37375396-37375418 TGCACCTGATTCCGAAAATCTGG - Intergenic
1126663712 15:51056474-51056496 TGCACTCGAACCCCAAGAGGAGG - Intergenic
1132734392 16:1378354-1378376 TGCACCCAAGTCCCAGGATCAGG + Intronic
1150840331 17:68600835-68600857 TGCACCTGGTCCCCAAGTTGAGG - Exonic
1165921970 19:39304920-39304942 TGCACACAATTTTCAAGATGAGG - Intergenic
1167772735 19:51531066-51531088 TGTACCCGCCTCCCAAGACGGGG + Intronic
931028075 2:58136285-58136307 TGCAACCCATTCCCACAATGAGG - Intronic
931431659 2:62213455-62213477 TGCACCCTTATCCCAAAATGGGG - Intronic
936228543 2:110679890-110679912 TGGCCCCGTTTCTCAAGATGAGG - Intergenic
936541145 2:113352593-113352615 TGCACCAGCTGCCCAGGATGAGG - Intergenic
940431178 2:153591915-153591937 TGCAAACTGTTCCCAAGATGAGG + Intergenic
948377958 2:237534461-237534483 AGCACCAAATTCCCAAGAAGCGG - Intronic
1169303877 20:4471380-4471402 TGCCCCAGCCTCCCAAGATGAGG - Intergenic
1174104021 20:48149304-48149326 TGCACTCCATATCCAAGATGGGG + Intergenic
1175544225 20:59767731-59767753 TGCAGCCAGTTCCCAGGATGGGG + Intronic
1181174297 22:21027170-21027192 TCCACCCCATTCCCTAGATTAGG - Exonic
1181693895 22:24583352-24583374 TGTACCTCATTCCCAAGATGAGG + Intronic
1182007438 22:26972513-26972535 GGCACCCGATTTCAGAGATGTGG + Intergenic
1183278130 22:36914093-36914115 TGCTCCCCATTCCACAGATGAGG - Intronic
1183743941 22:39682696-39682718 TGAAGCAGATGCCCAAGATGAGG - Intronic
952303311 3:32123665-32123687 TGCCCTCGATTCTCAAAATGCGG + Intronic
957461202 3:80522814-80522836 TGCACCCGAGTCCCTAAATCAGG + Intergenic
957951944 3:87138948-87138970 TGAACCAGATTTCCATGATGTGG - Intergenic
958406531 3:93762218-93762240 TGCACCTCATTTCCCAGATGGGG + Intergenic
965021170 3:163233346-163233368 TGCCCCCATTTCCTAAGATGAGG - Intergenic
969446332 4:7246798-7246820 TGCACACGATGGCCATGATGAGG + Intronic
982898498 4:160966111-160966133 TGCTCACGATACCCAAGATATGG - Intergenic
991064736 5:62412985-62413007 GGCACCCGAGTCCCGAGAGGCGG + Intronic
996801310 5:127406616-127406638 TGCACAGAATTCCCAGGATGTGG + Intronic
1007749533 6:44063395-44063417 TGCATCCCATTCCCAAGGAGGGG + Intergenic
1012681339 6:102185323-102185345 TGCACCTGTTTCCTAACATGTGG + Intergenic
1016363321 6:143290931-143290953 CCCACCCTCTTCCCAAGATGGGG + Intronic
1021960769 7:25870925-25870947 TTCACCCAATTCCCATGAGGTGG - Intergenic
1022866211 7:34423822-34423844 TTCACCCGACTCCCAAGGTGTGG - Intergenic
1025929258 7:65981640-65981662 TGCACCTGTTTCCCAGGCTGGGG - Intronic
1031560305 7:123230504-123230526 TTCACCAGATTCCCAGGAGGAGG - Intergenic
1052342623 9:27378675-27378697 TGCACAGGATTCCCCAGGTGTGG - Intronic
1059082376 9:111264287-111264309 TGCCCACGATACTCAAGATGAGG + Intergenic
1062015455 9:134288927-134288949 TTCACCCCATTCTCCAGATGAGG - Intergenic
1197056628 X:122128545-122128567 TGCACCAGTTGCCCTAGATGTGG + Intergenic
1198935178 X:141896733-141896755 TGCACAGGATTCCATAGATGAGG + Intronic
1199593479 X:149488861-149488883 TGCCCCAGAGGCCCAAGATGAGG + Intronic
1199598536 X:149526544-149526566 TGCCCCAGAGGCCCAAGATGAGG - Intronic