ID: 916701765

View in Genome Browser
Species Human (GRCh38)
Location 1:167303112-167303134
Sequence GGGGAGGTTAATGTCAAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916701759_916701765 4 Left 916701759 1:167303085-167303107 CCAGTAGATACTTGTATTGTATA 0: 1
1: 0
2: 0
3: 9
4: 107
Right 916701765 1:167303112-167303134 GGGGAGGTTAATGTCAAATGTGG 0: 1
1: 0
2: 0
3: 9
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916701765 Original CRISPR GGGGAGGTTAATGTCAAATG TGG Intronic
900999142 1:6139112-6139134 GGGGATGTTCATGTTTAATGGGG + Intronic
904628673 1:31824789-31824811 GTGGAGGTTAATATCACCTGTGG - Intergenic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
911573440 1:99545386-99545408 GGGGAGCTTGATTTCAACTGGGG - Intergenic
911989189 1:104670646-104670668 GTAGAGAGTAATGTCAAATGTGG + Intergenic
915438657 1:155929318-155929340 AGGGAGGTTCATGACAACTGAGG - Exonic
915646177 1:157274285-157274307 GGGGAGGTAAATATCAGTTGAGG + Intergenic
916701765 1:167303112-167303134 GGGGAGGTTAATGTCAAATGTGG + Intronic
917000086 1:170348029-170348051 GTAGAGGTTAATGTCACATGTGG + Intergenic
918321536 1:183369775-183369797 GAGGAGGTTAGTGTTTAATGAGG - Intronic
920557952 1:206917937-206917959 GGGGAGGCAAAGGTCAACTGAGG - Intronic
922889440 1:229048949-229048971 TGGGAGGTTAATGTGGAAAGGGG + Intergenic
922929331 1:229376648-229376670 GGGGAGGCTGATGTCAAGAGTGG - Intergenic
924646873 1:245886159-245886181 AAGGAGTTTAATGACAAATGTGG + Intronic
1063702552 10:8399916-8399938 GGCGAGGATAATTTCAACTGTGG - Intergenic
1066248442 10:33608638-33608660 GAGTAGGTAAATGTAAAATGGGG + Intergenic
1066722153 10:38351398-38351420 GGAGAGTTTATTTTCAAATGAGG + Intergenic
1068133121 10:52920196-52920218 GAGGTGGTTAAAGTAAAATGAGG + Intergenic
1068305938 10:55208425-55208447 GGGGAGGTGAATGTGAGAGGTGG - Intronic
1068354686 10:55896603-55896625 GGGGAGGTTATTGAAACATGGGG - Intergenic
1069957267 10:72059860-72059882 GGGGAGGTGGATGTCAGATCTGG - Exonic
1073049493 10:100658363-100658385 GGGGAGGTGGCTGTAAAATGGGG + Intergenic
1074227898 10:111505476-111505498 GGGGATGTGAAGGTCAAGTGTGG + Intergenic
1076200558 10:128554441-128554463 GGGTGGGTTAATGTAAACTGAGG + Intergenic
1081305900 11:41511895-41511917 GGGAAGGATAATGTGACATGTGG - Intergenic
1081880198 11:46443467-46443489 TGGTAAGTCAATGTCAAATGGGG - Exonic
1084576850 11:69994088-69994110 GGGGGGGTTAACGACAAATTGGG - Intergenic
1084915207 11:72423806-72423828 GGGGAGAGTGGTGTCAAATGAGG - Intronic
1085771083 11:79326459-79326481 GGGGAGGTTAGTTTGGAATGGGG - Intronic
1086464712 11:87041007-87041029 AGGGAGGATAATGTAAACTGAGG + Intronic
1089648126 11:119893713-119893735 GAGGAGGCTAATGTCAAAGATGG - Intergenic
1092377732 12:7969615-7969637 GGGAAGATAAATGTCAAAGGAGG + Intergenic
1093758492 12:22879270-22879292 GGGGAGATGATTATCAAATGAGG - Intergenic
1095714107 12:45322864-45322886 TGGGAGGATAAAGTCATATGTGG - Intronic
1099419443 12:82437527-82437549 TGGGAAGTTAATGTTAAATAAGG + Intronic
1099432623 12:82606057-82606079 TGGGATCCTAATGTCAAATGAGG - Intergenic
1101671983 12:106884119-106884141 GGGGAGGGCACTGTCAAGTGAGG - Intronic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1105530521 13:21214984-21215006 GGGGTGGTTAAGTTAAAATGAGG + Intergenic
1107824067 13:44311911-44311933 GGGGAGGTTCAGGATAAATGTGG - Intergenic
1110733790 13:78911200-78911222 GAGGTGATAAATGTCAAATGAGG + Intergenic
1110831892 13:80041378-80041400 AGGGAGGTTAAAGTCTAAGGTGG + Intergenic
1112204355 13:97309362-97309384 GGGGTGGTCAATTTAAAATGAGG + Intronic
1115736837 14:36341458-36341480 GGCCATGTTAATTTCAAATGGGG + Intergenic
1115879433 14:37898735-37898757 GGGGAGGGTATGGTCAATTGTGG + Intronic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1120025348 14:79577640-79577662 GAGGAGTTTATTGTCCAATGAGG - Intronic
1121704842 14:95983809-95983831 GGGGAGGGCAATGTCCAGTGAGG - Intergenic
1122246542 14:100407282-100407304 GGGGTTATTAATGTCAAAGGAGG - Intronic
1122304523 14:100753639-100753661 GTGGAGCTTAAAGTTAAATGGGG + Intergenic
1126841135 15:52718426-52718448 GGGGAGGCAGATGTAAAATGTGG + Intergenic
1128742071 15:70090614-70090636 GGGGAGGGGAGTGACAAATGGGG + Intronic
1129558900 15:76544655-76544677 TGGGAGGTTAGTGGGAAATGGGG + Intronic
1131672071 15:94630848-94630870 GCAGAGGTCAATGACAAATGAGG - Intergenic
1133145782 16:3785491-3785513 GGTGGGATTAATGTCAAATTCGG + Intronic
1135519061 16:23159527-23159549 GAGGAAATTAATGTTAAATGAGG - Intergenic
1138145947 16:54612008-54612030 GAGGTGATTAATGTAAAATGAGG + Intergenic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1139714613 16:68802861-68802883 GTGGAGGTTATAGTCTAATGGGG - Intronic
1140642708 16:76995060-76995082 GGGATGGTTGATGACAAATGGGG + Intergenic
1140986445 16:80162280-80162302 CTGGAAATTAATGTCAAATGTGG - Intergenic
1141673951 16:85507714-85507736 GAGGTGATTAAGGTCAAATGAGG - Intergenic
1142660167 17:1423577-1423599 GGGGAGTGTAATGGCAAACGAGG - Exonic
1143389400 17:6551411-6551433 GGGAAGGTTATGGTCAAATATGG - Intronic
1143454731 17:7059255-7059277 GGGGAGCATAATGGCAAATGAGG + Intergenic
1144718126 17:17448617-17448639 GATGAGGTTAATTTCAAACGAGG + Intergenic
1145037381 17:19550911-19550933 GGGGAGATTAAATTAAAATGAGG - Intronic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1146371471 17:32267321-32267343 GGGGTGGTGAATGCCGAATGCGG - Intronic
1146921647 17:36716698-36716720 GGTGAGGTTAGTGTTAATTGCGG + Intergenic
1148565741 17:48631867-48631889 GGGGAGGAAAAAGTCAACTGAGG + Intronic
1149074364 17:52578739-52578761 GGGGTGGTTAATGACAAAAGAGG + Intergenic
1149234571 17:54574897-54574919 AAGGAGGCTAAGGTCAAATGTGG - Intergenic
1151238597 17:72739863-72739885 GGGGAGTTTAAAGTTATATGTGG - Intronic
1152699150 17:81810663-81810685 GGGGAGGTGGAGGTCAAGTGGGG + Intronic
1153054765 18:935001-935023 GGTGAGGTTGATCTGAAATGTGG + Intergenic
1153347716 18:4046089-4046111 TGGCAGGTTAATGCCAGATGGGG - Intronic
1160427084 18:78785879-78785901 GTGGAGGTTAAGGTCAAAGTAGG - Intergenic
1161635691 19:5387523-5387545 AGGGAGGTCATTGTCAAGTGCGG + Intergenic
1164895331 19:31872185-31872207 GGGGAGTTGAATGTTAAAAGTGG - Intergenic
926135477 2:10332782-10332804 GGGGACTTTGATGTCAAAGGTGG + Intronic
927320143 2:21734302-21734324 GGTGGGGATACTGTCAAATGTGG - Intergenic
929001632 2:37352669-37352691 GGAGAACTTTATGTCAAATGAGG - Intronic
929217905 2:39436062-39436084 GAGGAGGTTGTTGCCAAATGTGG - Intronic
931483354 2:62665962-62665984 GGAGAGGTTAATGGAAGATGTGG + Intergenic
935175227 2:100643103-100643125 GAGGTGGTTAAGGTAAAATGGGG - Intergenic
935685992 2:105683290-105683312 GGAGGGGTTACTGTGAAATGTGG - Intergenic
938699421 2:133862924-133862946 AGGGCAGTCAATGTCAAATGTGG - Intergenic
940022337 2:149168437-149168459 GGGCAGGTTAAAGTTAAATTTGG - Intronic
943751875 2:191517707-191517729 GGGGAAGTTCTTCTCAAATGAGG + Intergenic
1169038267 20:2471041-2471063 GGGGAGGGTGATGGGAAATGAGG - Intronic
1172603437 20:36199041-36199063 GAGGAGGTTAACTTCAAATCAGG + Intronic
1177135520 21:17302408-17302430 GGGGTGGTTAATGACAGAAGAGG + Intergenic
1177796787 21:25787565-25787587 AGCAAGATTAATGTCAAATGTGG + Intergenic
1185187613 22:49411951-49411973 GGGGGGGTCAAAGTCACATGGGG - Intergenic
1185241071 22:49747865-49747887 GCTGAGGGTAATGGCAAATGAGG - Intergenic
951809474 3:26683534-26683556 GGGGATGTTGAACTCAAATGAGG + Intronic
956352475 3:68352872-68352894 GAGGAGGTAAATGACAGATGTGG - Intronic
958528713 3:95295501-95295523 GGGGTAGTTAAAGTTAAATGAGG + Intergenic
960974023 3:123158097-123158119 GGGGAGTTCAAGGACAAATGAGG - Intronic
961150585 3:124634429-124634451 GGGGAAGTTATTGTCAAAGGTGG + Intronic
961776819 3:129293006-129293028 GGGGGAGTTAGTGTGAAATGTGG + Intronic
965063195 3:163807155-163807177 GGGGTGGTTAATGACAGAAGAGG + Intergenic
965369598 3:167844611-167844633 GGGCATGTTGGTGTCAAATGTGG - Intergenic
965466343 3:169035171-169035193 GGATAGGTTAAGGTCAAATGTGG - Intergenic
967855231 3:194112380-194112402 AGGGAGGTTAAGGACAAATTTGG + Intergenic
970427691 4:15960782-15960804 GAGGTGGTTAAGGTAAAATGGGG + Intronic
972886286 4:43493288-43493310 GAGGAAGTTAAGGTTAAATGAGG + Intergenic
974559588 4:63499526-63499548 GGGGAGGGTAAGGGGAAATGAGG + Intergenic
979017868 4:115457967-115457989 GGGGTGGTTAAATTAAAATGAGG - Intergenic
979300671 4:119082943-119082965 GGTGAGGTCACTGTCAATTGAGG + Intergenic
979594074 4:122513792-122513814 GAGGATTTTAATGTCAACTGGGG + Intergenic
981824555 4:148925454-148925476 TGGGAGTTGAAGGTCAAATGGGG - Intergenic
982892037 4:160867244-160867266 GGGAAGGTTAGTGTCTGATGAGG + Intergenic
983576215 4:169264359-169264381 GAGGGGGTTAAGGTAAAATGAGG - Intronic
984110530 4:175607718-175607740 GATGAGGTTATTATCAAATGAGG - Intergenic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
985618580 5:939564-939586 TGGGAGGTAACTGTCAAATGAGG - Intergenic
987603894 5:20108034-20108056 GAGGCGATTAATGTAAAATGAGG - Intronic
989255697 5:39363667-39363689 GTGGAGGTTAGGGTCACATGAGG - Intronic
990167248 5:53008359-53008381 GAAGTGGTTAAGGTCAAATGAGG - Intronic
991218835 5:64188931-64188953 GGGAAAGTTAAGGTTAAATGAGG + Intronic
992390469 5:76326596-76326618 GGGAAGCTGAATGTCAACTGCGG - Exonic
993032626 5:82723013-82723035 GGGAAGGTGGATGTAAAATGCGG + Intergenic
995030390 5:107473957-107473979 GTGGATGTTAAAGTCAAATGAGG - Intronic
995663660 5:114515637-114515659 GGGGAGGTAAATGTCTGAAGAGG - Intergenic
996870519 5:128187178-128187200 GGGCAGGTTAATCAAAAATGGGG + Exonic
998151639 5:139760684-139760706 GAGGAGGGTAGTGGCAAATGGGG + Intergenic
998740892 5:145199996-145200018 GGGAAGATTAATGAAAAATGAGG - Intergenic
998747268 5:145275065-145275087 GAGGAGATTAAGGTAAAATGAGG - Intergenic
1002458272 5:179358487-179358509 GAGGAGATTAAGGTTAAATGAGG + Intergenic
1003400925 6:5790263-5790285 GGGGTGGTTAAGTTAAAATGAGG - Intergenic
1004408209 6:15354917-15354939 GGGGAGGTGAATTTCAGGTGGGG + Intronic
1004570455 6:16839822-16839844 GAGGAAATTAATGTTAAATGAGG - Intergenic
1008756796 6:54805614-54805636 GGGAATATTAATGCCAAATGTGG + Intergenic
1009377286 6:62988680-62988702 GGGTATATTAATGTCAAATAAGG - Intergenic
1010616605 6:78020566-78020588 GGGCAGGTTAATATGAATTGAGG - Intergenic
1010816292 6:80361494-80361516 AGGAAGGTTAAGGTGAAATGTGG + Intergenic
1014233714 6:118933129-118933151 AGGGAGGTTAAATTTAAATGAGG + Intronic
1014791789 6:125680938-125680960 AGGGAGGAGAATGTAAAATGAGG + Intergenic
1018613117 6:165662395-165662417 GGGGAGGTGAAAGGCAGATGAGG + Intronic
1019918154 7:4146613-4146635 GGGGAGCTCAACCTCAAATGTGG - Intronic
1019922407 7:4171509-4171531 CGGGACTTCAATGTCAAATGAGG - Intronic
1022160108 7:27701885-27701907 GAGGATGTGAATGTCACATGGGG - Intergenic
1024276518 7:47681550-47681572 GGGGACGCTATTGACAAATGGGG + Intergenic
1024332610 7:48171126-48171148 AGGGAGGTAAATGGTAAATGTGG + Intergenic
1033579586 7:142719980-142720002 GAGGTGGTTAAGGTTAAATGAGG + Intergenic
1033798127 7:144871510-144871532 GAAGAGGTTAAGGTAAAATGAGG - Intergenic
1036203911 8:6791510-6791532 GGGGAAGTGAATGAGAAATGTGG + Intergenic
1036369983 8:8154485-8154507 GGGGAGGTCATTGTCACAAGGGG - Intergenic
1036880909 8:12511145-12511167 GGGGAGGTCATTGTCACAAGGGG + Intergenic
1037597180 8:20364039-20364061 TAGGTGGATAATGTCAAATGAGG - Intergenic
1038375206 8:27033164-27033186 GGGTAGGTTAATATGAATTGAGG + Intergenic
1039203130 8:35118776-35118798 GGGAAGGGCAATGTGAAATGTGG + Intergenic
1041110127 8:54476085-54476107 GGGGAGAGGAATGTCAAGTGTGG - Intergenic
1041452086 8:58016373-58016395 CGGGAGGTTATTCTCAGATGTGG + Intronic
1041853983 8:62427989-62428011 GGGAAGGGTAATGGCAAGTGGGG - Intronic
1042064539 8:64859340-64859362 GGGGAGGTTAATCTGAATTGGGG - Intergenic
1043882951 8:85565544-85565566 GGGGTAATTAAGGTCAAATGAGG - Intergenic
1044515612 8:93134896-93134918 GGGGATGTTAATATCTAGTGAGG + Intronic
1044866245 8:96573995-96574017 GGGGAGAATAGGGTCAAATGAGG - Intronic
1048330653 8:133468479-133468501 GGGGAAGTTACTGTTTAATGGGG + Intronic
1050018669 9:1261702-1261724 GGAGAGATTTATGTCCAATGAGG + Intergenic
1055398752 9:75900740-75900762 GGGGAGGTAAAAAACAAATGGGG - Intronic
1057424521 9:94937446-94937468 GGGGTGGTTAAATTAAAATGAGG - Intronic
1203776769 EBV:77617-77639 GGGGAGGTTAATGTCACCAAAGG - Intergenic
1185773871 X:2786720-2786742 AAGGAGATTAATGTAAAATGAGG + Intronic
1186253809 X:7698710-7698732 GTGAACGTTAATGTCAACTGTGG - Intergenic
1187039086 X:15574296-15574318 GGGGAGATAAATGGCAAAGGAGG - Intronic
1187361915 X:18636449-18636471 GGGCAGGTTAATGTCAAGTATGG - Intronic
1189368370 X:40407668-40407690 GGAGATGTTAGTGTCACATGAGG + Intergenic
1192451272 X:71246554-71246576 GGGGAGGATAATCTCAGAGGAGG - Intronic
1192580204 X:72274798-72274820 GAGGAAGTTAACTTCAAATGGGG + Intronic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1195861052 X:109383562-109383584 GTGGAGCTTAATGTCATATTTGG + Intronic
1196837974 X:119831013-119831035 CAGGAGGGAAATGTCAAATGAGG - Intergenic
1198488860 X:137117712-137117734 GGGAAGGTTAAGGTGAAGTGGGG + Intergenic