ID: 916705788

View in Genome Browser
Species Human (GRCh38)
Location 1:167348366-167348388
Sequence TTTGAAGGACCATCAAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916705788 Original CRISPR TTTGAAGGACCATCAAAAAG TGG (reversed) Intronic
911546155 1:99219546-99219568 TTTGAATGATTATCAAGAAGTGG + Intergenic
912055399 1:105592014-105592036 TTTGAAACACCATGCAAAAGAGG - Intergenic
916094615 1:161338033-161338055 TTTCAAGGACAACAAAAAAGAGG - Intronic
916665117 1:166959550-166959572 TTTGAAGGATAATCAAAAGAAGG + Intronic
916705788 1:167348366-167348388 TTTGAAGGACCATCAAAAAGTGG - Intronic
918425322 1:184403987-184404009 TTTGAAGGAACATAATAAATAGG + Intronic
921245772 1:213238256-213238278 TCTGAAGGACCTTCAAGAATAGG + Intronic
922105895 1:222514162-222514184 TTCTAAGAACCACCAAAAAGGGG - Intergenic
922266234 1:223986773-223986795 TTCTAAGAACCACCAAAAAGGGG - Intergenic
924348079 1:243091729-243091751 TTCTAAGAACCACCAAAAAGGGG - Intergenic
1063305492 10:4895655-4895677 TTTGGAGGTTCATCAAAAAACGG - Intergenic
1064135471 10:12746931-12746953 TTTGGAGAACCATAAAACAGGGG - Intronic
1065158834 10:22897841-22897863 TTTCAAATCCCATCAAAAAGTGG + Intergenic
1065475750 10:26136200-26136222 TGGGTAGGACCATAAAAAAGTGG + Intronic
1066728279 10:38413172-38413194 TTCTAAGAACCACCAAAAAGGGG + Intergenic
1067183066 10:44005145-44005167 TTTCAAGGACCAGGAAGAAGGGG + Intergenic
1068566486 10:58581446-58581468 TTTCAAGGATCATAAAACAGAGG - Intronic
1068578768 10:58714683-58714705 TTTGAGAAACCATCAAAATGTGG - Intronic
1069096657 10:64267458-64267480 TTTGAAAGTCCAACACAAAGGGG - Intergenic
1069608794 10:69758353-69758375 TTTGAATGGCCATGAAAAATAGG - Intergenic
1073512895 10:104053467-104053489 TTTTAAGGAGCATCAGGAAGGGG - Intronic
1079801919 11:24879749-24879771 TTTCCAGCCCCATCAAAAAGTGG - Intronic
1081003945 11:37710269-37710291 TTTGCAGAACTAGCAAAAAGGGG + Intergenic
1082677221 11:56120248-56120270 TTTGAAGCATTATCAGAAAGTGG - Intergenic
1083432410 11:62621029-62621051 TTTGAAAGACTGTCCAAAAGGGG - Intronic
1086014234 11:82146051-82146073 TTTAAAGGGACATTAAAAAGTGG + Intergenic
1086096299 11:83053162-83053184 TTTGAAGGAGCATGAAGTAGAGG + Intronic
1086967129 11:93040768-93040790 TTTAAAAATCCATCAAAAAGAGG - Intergenic
1087033211 11:93727317-93727339 TTTGAAGAACTATCAAAAAGAGG + Exonic
1087404473 11:97712863-97712885 TTTAATGGACCACAAAAAAGGGG + Intergenic
1092430357 12:8403842-8403864 CTTGAATGAGCATTAAAAAGAGG - Intergenic
1093862711 12:24186981-24187003 TTTGTAGAACCATCAAAACTTGG + Intergenic
1097902647 12:64888828-64888850 TTAGAAGGACCGTCACCAAGTGG - Intergenic
1098031591 12:66260445-66260467 CTTAAAGGACCTTCAAAAACTGG + Intergenic
1100709182 12:97235888-97235910 TTTAAAGTACCATTAAAAAGTGG - Intergenic
1107821246 13:44287617-44287639 TTAGAAGCACAATCAATAAGAGG - Intergenic
1107922098 13:45219399-45219421 TTTGAAGGTCATTCAATAAGAGG - Intronic
1109209442 13:59517594-59517616 TTAGAAGAAACATCAAAGAGTGG - Intergenic
1109641587 13:65198824-65198846 GTTCAAGGACCATCAACTAGTGG - Intergenic
1110918004 13:81047383-81047405 TTTCAAAGAACTTCAAAAAGGGG + Intergenic
1111831771 13:93339199-93339221 TTTTAAAGACCATCAGATAGAGG - Intronic
1112826136 13:103394146-103394168 TTTGAATGACTATAAAAAATGGG - Intergenic
1114588679 14:23839139-23839161 TTTGAACAACCATCAAGAACTGG - Intergenic
1114760594 14:25309470-25309492 TTAAAAAGTCCATCAAAAAGTGG + Intergenic
1114943230 14:27642979-27643001 TTTGAATGAGCAAAAAAAAGTGG - Intergenic
1116131148 14:40856590-40856612 TTTGAAGGACCTCCTGAAAGTGG + Intergenic
1117062167 14:51974077-51974099 TTTGACAAAACATCAAAAAGAGG + Intronic
1121389367 14:93561191-93561213 AGTGAAGGAACATCAAGAAGGGG + Intronic
1122749914 14:103925533-103925555 TTTGAGCGTCCACCAAAAAGGGG - Intronic
1129633041 15:77282901-77282923 TTTAAGGCACCATTAAAAAGTGG + Intronic
1130343017 15:83015026-83015048 TTTGAAGAAGCACTAAAAAGTGG + Intergenic
1132130265 15:99270832-99270854 TTTGAGGAGCCACCAAAAAGTGG + Intronic
1133135272 16:3706767-3706789 TCTGAAGGTCCATCAGAAGGTGG - Intronic
1136253317 16:29021630-29021652 CTTGATGGATCTTCAAAAAGTGG + Intergenic
1137356464 16:47770489-47770511 TTAAAAAAACCATCAAAAAGTGG - Intergenic
1138142863 16:54583405-54583427 TTCCATGGGCCATCAAAAAGTGG - Intergenic
1145988712 17:29065233-29065255 TTTGCAGGACCCTAAATAAGAGG + Intergenic
1152251117 17:79213169-79213191 TTTTAATGACAATGAAAAAGAGG + Intronic
1203167806 17_GL000205v2_random:114114-114136 TTTGAAGGACCTACAGAGAGTGG + Intergenic
1153645631 18:7193606-7193628 TTTGTAAGACCATCCCAAAGTGG - Intergenic
1154108213 18:11542943-11542965 TTAGAAGTACCACAAAAAAGAGG + Intergenic
1154983465 18:21524393-21524415 TTTGAAGGACAATTAAAAATGGG - Exonic
1155755471 18:29489705-29489727 TTTCAATAACCATCATAAAGTGG + Intergenic
1156648069 18:39190909-39190931 TTTGAAGGAAGAGTAAAAAGAGG + Intergenic
1165016077 19:32880957-32880979 TGTGAAGGACCCTCAAAGAAAGG + Intronic
1167029701 19:46949709-46949731 TTTGAAGGAACAGAAAAATGAGG - Intronic
1167977542 19:53242467-53242489 TTGGAATGGCAATCAAAAAGAGG + Intronic
1168482947 19:56736838-56736860 TTTGAAGGACTCTCACAAAATGG - Intergenic
926548658 2:14273600-14273622 TTTTTAGGACCTTGAAAAAGTGG + Intergenic
927356454 2:22178897-22178919 TTTAAAGTACGATAAAAAAGTGG + Intergenic
930237853 2:48904756-48904778 TTTGAAGCAGCATCACACAGGGG + Intergenic
931859892 2:66344021-66344043 TTAGAAGGATCAGCAGAAAGGGG + Intergenic
933612059 2:84446413-84446435 TTTCAAGGACCTTCAAAATGTGG + Intronic
937530161 2:122818530-122818552 TTTGCAAGACCAGCAAAGAGAGG + Intergenic
945189550 2:207172599-207172621 TTTACAGGATAATCAAAAAGAGG + Intergenic
945379251 2:209119944-209119966 TTGGAAGGACCATTAGAAATGGG + Intergenic
947432390 2:230042589-230042611 TCTGAAGGACCTCCAACAAGAGG + Intronic
1169747705 20:8959684-8959706 CTTGGAGGACCCTCAAAGAGAGG + Intronic
1170397927 20:15947911-15947933 TTGGATGCACCAGCAAAAAGTGG - Intronic
1170698960 20:18685953-18685975 TTTGTAGGCCCATCGTAAAGTGG + Intronic
1173901928 20:46596594-46596616 TCTAAATGCCCATCAAAAAGGGG + Intronic
1174937503 20:54887078-54887100 TTTTATGTACCCTCAAAAAGTGG - Intergenic
1174945375 20:54979717-54979739 TTGGAAGAACCTTCATAAAGTGG + Intergenic
1176403951 21:6345022-6345044 TTTGAAGGACCTACAGAGAGTGG - Intergenic
1176433206 21:6644082-6644104 TTTGAAGGACCTACAGAGAGTGG + Intergenic
1177088441 21:16736274-16736296 TTAAAAAAACCATCAAAAAGTGG + Intergenic
1177778721 21:25599507-25599529 TTAGAAGGAACATCAAGAAAAGG + Intronic
1177783253 21:25641976-25641998 TTTGGAGGAAGATCAGAAAGTGG + Intronic
1178786090 21:35655065-35655087 TTTGAATGATCATCAAATATGGG - Intronic
1178851010 21:36212354-36212376 CTTGAAATACCACCAAAAAGTGG + Intronic
1182032610 22:27171306-27171328 GTTGCAGGACCATAATAAAGAGG + Intergenic
1182043324 22:27255195-27255217 TTTTAAGTACTAGCAAAAAGTGG - Intergenic
1182705004 22:32271472-32271494 TGTGAAGGACCTTCTTAAAGTGG - Intergenic
1183980259 22:41535517-41535539 TCTAAAGGACCATCAAGAAGAGG + Intronic
949171469 3:1003565-1003587 TTTCAATGACCATCAAAACAAGG - Intergenic
949607126 3:5665211-5665233 TCTGAAGGACCCTCAAAGACTGG + Intergenic
952441549 3:33335371-33335393 TTTAAAGGACTTTTAAAAAGAGG - Intronic
957073988 3:75587367-75587389 CTTGAATGAGCATGAAAAAGAGG - Intergenic
957744266 3:84318201-84318223 TATGGAGCACCATCAGAAAGTGG - Intergenic
960037323 3:113114935-113114957 CTTGAAGGAACATCAAGAAAAGG - Intergenic
962239469 3:133739654-133739676 TATGAACAACCATCAAAAAGTGG + Intergenic
964127189 3:153246984-153247006 TTTGGAGGAGAAGCAAAAAGTGG - Intergenic
966460775 3:180173928-180173950 TTTGAAGGGCCATCCATAACTGG - Intergenic
966460938 3:180175621-180175643 ATTGAAACACCATCAATAAGTGG - Intergenic
969025792 4:4171368-4171390 TTTGAAGGACCATCTCACATGGG - Intergenic
969451984 4:7279173-7279195 TTTGAACCACCACCAAAAAAGGG - Intronic
971099876 4:23453931-23453953 TTGGAAGGACCACCACAGAGGGG + Intergenic
971988349 4:33857545-33857567 TTTGGAAGACCATCACAAAAAGG + Intergenic
974232011 4:59128581-59128603 TTTGCTGCACCATCAAAAATTGG - Intergenic
975631545 4:76409014-76409036 GTTGAAACCCCATCAAAAAGTGG - Intronic
975945644 4:79702755-79702777 GTTGAAGGACCAAAAAAAAAAGG - Intergenic
976673687 4:87681344-87681366 GTTGAAGGAACAATAAAAAGAGG + Intergenic
977196628 4:94070100-94070122 TTTGAAGGACCATTAAAAAGGGG - Intergenic
978241536 4:106522760-106522782 TTTGAAAGGCCATTAAAATGAGG + Intergenic
979975612 4:127192595-127192617 TTTAAAGTAGCACCAAAAAGAGG - Intergenic
980305482 4:131055133-131055155 TTCCCAGCACCATCAAAAAGTGG - Intergenic
983823088 4:172221425-172221447 TTTGAATAACCATCAACAAGGGG + Intronic
983942912 4:173554831-173554853 TATGAAGGTCCATCAATAGGGGG - Intergenic
984707367 4:182857468-182857490 TTTGCAGGAGCATGAAGAAGGGG + Intergenic
986222866 5:5785916-5785938 TTTGGAGGACCATCAAACCAGGG + Intergenic
986518428 5:8587455-8587477 TTAAAAAAACCATCAAAAAGTGG + Intergenic
986575279 5:9205915-9205937 TTTCAAAGACAATGAAAAAGTGG + Intronic
987038017 5:14037326-14037348 TTAGAGGGACCATCAAGAAGGGG + Intergenic
987902844 5:24035963-24035985 TTTCCAGCTCCATCAAAAAGTGG - Intronic
990876580 5:60493302-60493324 TTTGAAGGAGGAGAAAAAAGAGG + Intronic
991339958 5:65598057-65598079 TTAGAAGGAACATCCAAAAATGG - Intronic
992404125 5:76440430-76440452 GTTGAAGGACATTCCAAAAGAGG + Intronic
994287652 5:97989730-97989752 TTTGCAATCCCATCAAAAAGTGG + Intergenic
994306383 5:98210321-98210343 GTTGAAGTGCTATCAAAAAGAGG - Intergenic
995943805 5:117617857-117617879 TATAAAGGAACATCAAGAAGAGG - Intergenic
1000081720 5:157854831-157854853 TTTGAATCACTATCAAAAAAAGG + Intronic
1002725451 5:181291518-181291540 TTCTAAGAACCACCAAAAAGGGG + Intergenic
1002973824 6:2053021-2053043 TTTAAAAAACAATCAAAAAGTGG - Intronic
1004772522 6:18800324-18800346 CTAGAATGACCAACAAAAAGAGG - Intergenic
1005322679 6:24670351-24670373 TATCATGGAACATCAAAAAGAGG - Intronic
1005561173 6:27042935-27042957 TTTGCATGGCTATCAAAAAGTGG + Intergenic
1007224737 6:40305068-40305090 TGTGAAGGACAAGGAAAAAGTGG + Intergenic
1013142969 6:107358389-107358411 TTTGAAATAACATCAAAAATAGG - Intronic
1013325454 6:109041467-109041489 TTTTGAGGACAATGAAAAAGCGG + Intronic
1014331070 6:120064161-120064183 GTTCAAGGCCCATCAAAGAGAGG - Intergenic
1015687320 6:135879510-135879532 TCTGCAGGACCTACAAAAAGTGG + Intronic
1015874094 6:137805399-137805421 TTGGAAAAACCATCAATAAGAGG - Intergenic
1016066018 6:139684039-139684061 TTTGAAGGACTAGAAAAAATTGG + Intergenic
1016780558 6:147952812-147952834 TTTCAAAGATCATCAAAAAAGGG - Intergenic
1018312412 6:162524745-162524767 TTTGATGTAGTATCAAAAAGTGG - Intronic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1024713454 7:52045205-52045227 TTTGCAACCCCATCAAAAAGGGG - Intergenic
1025274622 7:57567081-57567103 TTTGGAAGACCATCACAAAAAGG + Intergenic
1025989948 7:66490237-66490259 TTCTAAGAACCACCAAAAAGGGG - Intergenic
1026038793 7:66848341-66848363 TTCTAAGAACCACCAAAAAGGGG + Intergenic
1026768545 7:73176684-73176706 TTCTAAGAACCACCAAAAAGGGG + Intergenic
1027009415 7:74730056-74730078 TTCTAAGAACCACCAAAAAGGGG + Intronic
1027078628 7:75215972-75215994 TTCTAAGAACCACCAAAAAGGGG - Intergenic
1027212575 7:76163220-76163242 TTCTAAGAACCACCAAAAAGGGG - Intergenic
1029947814 7:104551837-104551859 TTTGAAGCACAATCTACAAGAGG + Intronic
1030448984 7:109685073-109685095 TGTGAAGCAACATAAAAAAGAGG - Intergenic
1031942116 7:127800022-127800044 TGTTAAGGACCATAAAACAGTGG + Intronic
1034362417 7:150512205-150512227 TTTGAAGGACCATTCCCAAGAGG + Intergenic
1040415720 8:47193610-47193632 CTTGAAGGTCAATGAAAAAGTGG - Intergenic
1040487498 8:47887221-47887243 TGTGAAGGACCACCAAGGAGAGG + Intronic
1040713346 8:50216870-50216892 TTTGGAGAACCATCACTAAGAGG + Intronic
1041265018 8:56055975-56055997 TTTGAAGGAGCCTGAAAAAGGGG + Intergenic
1041631287 8:60090398-60090420 TTTGAAGGTCCATCTAACATGGG - Intergenic
1044725117 8:95188444-95188466 TTTGTAACCCCATCAAAAAGTGG + Intergenic
1046138176 8:110058744-110058766 TATGAAGGATCAGCAAAATGTGG - Intergenic
1048136987 8:131756180-131756202 TTTAAAGGATCATAAAAAATAGG - Intergenic
1048963813 8:139600696-139600718 TTGCAAGGAGCAGCAAAAAGGGG + Intergenic
1049514853 8:143048832-143048854 GTTGAAGGACCATCTGAAGGAGG - Intronic
1052394251 9:27919108-27919130 TTAAAAAGACCATTAAAAAGAGG - Intergenic
1052596211 9:30561404-30561426 TTTCAAGGACTATCAAACAAAGG - Intergenic
1053282126 9:36827213-36827235 TTGGAGGTACCTTCAAAAAGGGG - Intergenic
1054707079 9:68473633-68473655 TTTGAAGCACAATCACAAGGAGG - Intronic
1055355745 9:75435446-75435468 TTTCAAGGACAATCTGAAAGAGG - Intergenic
1055849050 9:80603177-80603199 TATGAAGGACAATGAACAAGAGG + Intergenic
1056034995 9:82595114-82595136 TTTAAAGAACCATCAACAAGTGG + Intergenic
1056306174 9:85292762-85292784 TTTGAAGCCCCATTAAGAAGGGG - Intergenic
1058433822 9:104943448-104943470 TTTAAATGACTATAAAAAAGAGG - Intergenic
1061339534 9:129968079-129968101 TTTGAAAGAACATGTAAAAGTGG - Intronic
1061838142 9:133342583-133342605 TTTGGGGGACCAGCAAGAAGGGG + Intronic
1203438329 Un_GL000195v1:164588-164610 TTTGAAGGACCTACAGAGAGTGG - Intergenic
1187998598 X:24956449-24956471 GTTGAAGGACCATTTAAAAAGGG + Intronic
1188258247 X:27988614-27988636 TATGAAAGACTAGCAAAAAGGGG + Intergenic
1191008051 X:55731862-55731884 TTTGAAGGACAATAAAACTGGGG - Intronic
1191909859 X:66137821-66137843 TGTCAAAGATCATCAAAAAGTGG - Intergenic
1193587078 X:83337325-83337347 TATGAACGAACATCACAAAGTGG + Intergenic
1196950183 X:120869153-120869175 GAAGAAGGACCATGAAAAAGCGG - Intergenic