ID: 916709174

View in Genome Browser
Species Human (GRCh38)
Location 1:167387102-167387124
Sequence CGTTCTCTGCATATGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916709166_916709174 5 Left 916709166 1:167387074-167387096 CCTATACCAGAGACTTCTTCCTG 0: 1
1: 0
2: 0
3: 21
4: 188
Right 916709174 1:167387102-167387124 CGTTCTCTGCATATGGTGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 120
916709168_916709174 -1 Left 916709168 1:167387080-167387102 CCAGAGACTTCTTCCTGGCCTCC 0: 1
1: 0
2: 2
3: 42
4: 361
Right 916709174 1:167387102-167387124 CGTTCTCTGCATATGGTGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916709174 Original CRISPR CGTTCTCTGCATATGGTGGC AGG Intronic
900485380 1:2920346-2920368 CGCTCACTGCAGATGGGGGCAGG + Intergenic
909439942 1:75685973-75685995 TGTTCTTTACACATGGTGGCAGG + Intergenic
913386421 1:118262820-118262842 GATTCTCTGCAGATAGTGGCTGG - Intergenic
916709174 1:167387102-167387124 CGTTCTCTGCATATGGTGGCAGG + Intronic
918925662 1:190782457-190782479 AGTTCTCTGCATAGGGAGGAGGG - Intergenic
924741152 1:246794919-246794941 CGTTCTGTGTAAGTGGTGGCTGG - Intergenic
1066353039 10:34655018-34655040 CGTGCTCAGCAAATGGTGGGTGG - Intronic
1067834020 10:49626968-49626990 CTTCCTCTGCATATGATTGCTGG + Intronic
1068158199 10:53228525-53228547 CATTTTCTTCATAAGGTGGCAGG + Intergenic
1068422826 10:56819198-56819220 GTTTCTCTTCACATGGTGGCAGG + Intergenic
1070665244 10:78337993-78338015 CCTTCGCTGCTTATGGAGGCGGG + Intergenic
1070845374 10:79518458-79518480 AATTCTCTGGGTATGGTGGCAGG + Intergenic
1070928420 10:80241856-80241878 AATTCTCTGGGTATGGTGGCAGG - Intergenic
1072240695 10:93493053-93493075 GGTGCTCAGGATATGGTGGCTGG + Intergenic
1078176463 11:8975129-8975151 CCCTCTCTGATTATGGTGGCTGG + Intergenic
1081110475 11:39128391-39128413 AGTTATCTGCATAAGATGGCAGG - Intergenic
1084748353 11:71187898-71187920 CGTGCTGTGCATGTGGTGCCGGG + Intronic
1088410802 11:109532294-109532316 AGATCTCTGCATATGGAGTCAGG - Intergenic
1091289967 11:134433954-134433976 CCTTGTCTGCATCTGGGGGCAGG + Intergenic
1093392086 12:18635562-18635584 GGTTATCTGCATAAGATGGCAGG + Intronic
1099778502 12:87165045-87165067 CATTTTCTTCATAAGGTGGCAGG + Intergenic
1103300320 12:119921308-119921330 TTTTCTCTGCATAGGGTGGAAGG - Intergenic
1108524643 13:51276325-51276347 CATTCTCTGCATAGAATGGCAGG - Intronic
1109640913 13:65190575-65190597 ATTTCTCTGCATATGTTGGATGG - Intergenic
1112453195 13:99531498-99531520 GGTTCTATGCATATGGGGGTTGG - Intronic
1112818594 13:103303515-103303537 TGTTTTCTGCATATTGTGTCTGG + Intergenic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1117033702 14:51704654-51704676 CCTTCTCTCCATCTGGTGACAGG - Intronic
1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG + Intergenic
1120838393 14:89061527-89061549 ACTTCTCTGCAAAGGGTGGCTGG + Intergenic
1127601590 15:60543040-60543062 GGTTCTCAGCAAGTGGTGGCAGG - Intronic
1133452029 16:5911769-5911791 CCATGTCTGCATATGGTGGGAGG + Intergenic
1134344639 16:13378341-13378363 AGCTCTCTCCATGTGGTGGCAGG + Intergenic
1135513305 16:23107261-23107283 TGCTCTCTGCATGTGGTAGCAGG - Intronic
1139229154 16:65265966-65265988 GATTCTCTGCAAATGATGGCTGG + Intergenic
1139372022 16:66474894-66474916 CGGTCTCTTCATCTGGTGGAAGG + Intronic
1140327401 16:74018193-74018215 AATTGTCTGCATGTGGTGGCGGG - Intergenic
1143521847 17:7448772-7448794 CATTACCTGCATCTGGTGGCAGG - Exonic
1144173518 17:12682631-12682653 CATCCTCTCCATATGGTGCCAGG - Intronic
1146537962 17:33669614-33669636 CGTTCTCTATATTTGGGGGCAGG - Intronic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1155965017 18:32027561-32027583 CGATCTCTGCCTATAGTGCCTGG - Intronic
1157571348 18:48714380-48714402 CCTTCCCTTCATATGGTGGGGGG - Intronic
1161481648 19:4513691-4513713 CTTTCTCAGCAGATGGTGTCCGG - Exonic
1162498309 19:11035688-11035710 CGTTCTCAGCAGATGGCAGCTGG + Intronic
1162534054 19:11252883-11252905 CGGGCTCAGCATCTGGTGGCCGG + Exonic
1164854846 19:31512816-31512838 CCCTCTCTGCACCTGGTGGCTGG - Intergenic
1167678947 19:50907553-50907575 AGTTAGCTGGATATGGTGGCAGG - Intronic
925900922 2:8508912-8508934 AGTTCTGTGCATCTGGTGGTGGG - Intergenic
927707313 2:25304480-25304502 GGATCGCTGCATATGGTGGGCGG - Intronic
932303498 2:70685360-70685382 CCTTCTCTTCATAGGGTGACGGG - Intronic
932388611 2:71362910-71362932 ACTTCTGTGCATATGCTGGCCGG + Intronic
933981548 2:87554870-87554892 CATTCTCTGAAGATGGGGGCAGG - Intergenic
935026627 2:99283194-99283216 CATCCTCTTCATATGATGGCAGG - Intronic
936312288 2:111395946-111395968 CATTCTCTGAAGATGGGGGCAGG + Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
940737314 2:157467928-157467950 CTTTCTCAGAGTATGGTGGCTGG - Intronic
946790918 2:223299731-223299753 AGTTATCTGCAAATGATGGCAGG - Intergenic
947831060 2:233142154-233142176 CAGTCTCTGCATTTGGTGGCAGG + Intronic
948517070 2:238510793-238510815 CATTCCCTGCGTATGGTGTCTGG - Intergenic
1172108012 20:32528110-32528132 CGTTCTCTGCCCATTGTTGCTGG - Intronic
1177966563 21:27735221-27735243 TGTTCTCTGCATACAGAGGCTGG - Intergenic
1180176639 21:46093741-46093763 CTTCCTCTGCAAGTGGTGGCAGG + Intergenic
1182926464 22:34129837-34129859 TGTTGTCTCCATATGCTGGCTGG - Intergenic
1183690286 22:39384336-39384358 CTTTCCCTGCCTAGGGTGGCAGG - Exonic
1184736837 22:46403822-46403844 CATTATCTGGATGTGGTGGCAGG + Intronic
1185146676 22:49141000-49141022 CGTCCTCTGCATTTGCTGTCTGG - Intergenic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
951753328 3:26061306-26061328 CATTTTCTCCACATGGTGGCTGG + Intergenic
955391281 3:58524262-58524284 CTCTCTCTGCCCATGGTGGCAGG + Intronic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
966661310 3:182417979-182418001 AGTTATCTGCAAATGATGGCAGG - Intergenic
970300489 4:14676561-14676583 CGTCATCTGTATATGGTGACAGG - Intergenic
970897585 4:21121233-21121255 CTTTTTCTGCATAAGGGGGCCGG - Intronic
972048870 4:34702885-34702907 CCTGCTCTGGAGATGGTGGCAGG - Intergenic
973121403 4:46524257-46524279 TGTTCTCTGCATATGGTCAAAGG + Intergenic
975158310 4:71096229-71096251 AATTCTCTGCATAGGGTGGCTGG + Intergenic
977177225 4:93832227-93832249 CGTTCTCTGCATCTCTTGGTCGG - Intergenic
978603027 4:110448417-110448439 CGTGCTCAACAAATGGTGGCTGG - Intronic
982091892 4:151887233-151887255 CCTTCTCTGCATCTGGCAGCTGG - Intergenic
985107140 4:186510443-186510465 TTTTCTCAGCATATGGAGGCTGG + Intronic
987016759 5:13827906-13827928 CGTCCTTTTCACATGGTGGCAGG - Intronic
987800910 5:22695552-22695574 TGTTTTCTGCATATGCTAGCCGG - Intronic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
988671683 5:33388503-33388525 AATTATCTGGATATGGTGGCAGG + Intergenic
989380240 5:40803165-40803187 CTATCTCTAAATATGGTGGCTGG + Intergenic
990937788 5:61168523-61168545 CGTTCTTTTCATATGTTTGCAGG + Intergenic
993689578 5:90982822-90982844 CGCACTCTGCATGTGGTGGGAGG + Intronic
993947450 5:94132675-94132697 AATTCTCTGCACATGGTGGCGGG - Intergenic
994294679 5:98076753-98076775 CGCTTTCTTCACATGGTGGCAGG - Intergenic
994944829 5:106374001-106374023 CGCTCTCTGCAGATGGAGGATGG - Intergenic
995164956 5:109028933-109028955 CATTCTATGCACATGGTGCCTGG - Intronic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996098591 5:119424620-119424642 CTTGCTCTGCATATTCTGGCTGG + Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
999525352 5:152399513-152399535 CCTTCTCTGCATATGAGGTCTGG + Intronic
1002703042 5:181140814-181140836 TGTTTTCTGCATTTGGTGCCTGG + Intergenic
1002955148 6:1855145-1855167 CAATCTCTGCATATGGTGTCAGG + Intronic
1009732862 6:67633280-67633302 CACTGTCTTCATATGGTGGCAGG - Intergenic
1011170445 6:84499063-84499085 TGTTCTCACCATGTGGTGGCTGG - Intergenic
1012252106 6:96991365-96991387 GTTTCTCTCCGTATGGTGGCTGG + Intronic
1013841568 6:114401855-114401877 TGTTCTCTGCATTTTGTGACTGG - Intergenic
1030657954 7:112188996-112189018 TATGCTCTGCATATGGTGGCTGG - Intronic
1038405118 8:27315923-27315945 TATTCTTTGCATATGGTGGGGGG + Intronic
1041663050 8:60417351-60417373 GGCTCTCTGCATATGGTGCACGG - Intergenic
1049648385 8:143748337-143748359 GGTTCTATCCATATGGGGGCGGG + Intergenic
1050808464 9:9714718-9714740 AGTTCTCTGCTGATGGTGGGAGG + Intronic
1055581093 9:77707301-77707323 GGTTCTCTGTCTATGCTGGCTGG + Intergenic
1059833142 9:118120999-118121021 GTTTCTATGCATATGGTGGGTGG + Intergenic
1061009475 9:127946514-127946536 GGTTCTCTGCATATGGGGGGAGG + Intronic
1203452643 Un_GL000219v1:134434-134456 TGTTCTCTGCAGATATTGGCTGG + Intergenic
1186556026 X:10559717-10559739 CTTTCTCTGTTGATGGTGGCAGG - Intronic
1187052300 X:15707136-15707158 CCTTCTCAGCATATGGTGTCAGG - Intronic
1190151527 X:47954052-47954074 CTCTCTCTGCAGATGGTGGCAGG + Intronic
1190161206 X:48032672-48032694 CTCTCTCCGCAGATGGTGGCAGG - Intronic
1190831695 X:54064509-54064531 GGTTCTCTGCATGTGGTCGGAGG - Intergenic
1192508502 X:71706940-71706962 TTTTGTCTGCTTATGGTGGCAGG + Intergenic
1192512145 X:71727776-71727798 TTTTGTCTGCTTATGGTGGCAGG - Intergenic
1192514552 X:71753729-71753751 TTTTGTCTGCTTATGGTGGCAGG + Intergenic
1192518195 X:71774613-71774635 TTTTGTCTGCTTATGGTGGCAGG - Intergenic
1192527486 X:71860295-71860317 TTTTCTCCGCCTATGGTGGCAGG + Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194306865 X:92258514-92258536 CATTCTCTGGGCATGGTGGCGGG - Intronic
1195166381 X:102224595-102224617 CATTCACTGCATGTGGGGGCAGG + Intronic
1195192479 X:102462493-102462515 CATTCACTGCATGTGGGGGCAGG - Intronic
1197521993 X:127510339-127510361 AGTTATCTGTAGATGGTGGCAGG - Intergenic
1200129252 X:153831974-153831996 CGGTCTCTGCAGCTGGTGGATGG + Intergenic
1200253516 X:154566686-154566708 CTTTCTCAGCATCTGGGGGCGGG + Intergenic
1200264251 X:154637722-154637744 CTTTCTCAGCATCTGGGGGCGGG - Intergenic