ID: 916712171

View in Genome Browser
Species Human (GRCh38)
Location 1:167421339-167421361
Sequence AATCTCCTTGGACTAAGAAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916712171_916712174 14 Left 916712171 1:167421339-167421361 CCATTTCTTAGTCCAAGGAGATT 0: 1
1: 0
2: 1
3: 18
4: 153
Right 916712174 1:167421376-167421398 CACCCCTGAGATTTCCAGTAAGG 0: 1
1: 0
2: 0
3: 13
4: 101
916712171_916712178 25 Left 916712171 1:167421339-167421361 CCATTTCTTAGTCCAAGGAGATT 0: 1
1: 0
2: 1
3: 18
4: 153
Right 916712178 1:167421387-167421409 TTTCCAGTAAGGTATTTGAAAGG 0: 1
1: 0
2: 1
3: 19
4: 225
916712171_916712173 -10 Left 916712171 1:167421339-167421361 CCATTTCTTAGTCCAAGGAGATT 0: 1
1: 0
2: 1
3: 18
4: 153
Right 916712173 1:167421352-167421374 CAAGGAGATTAAATATAAATAGG 0: 1
1: 0
2: 1
3: 32
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916712171 Original CRISPR AATCTCCTTGGACTAAGAAA TGG (reversed) Exonic
901618922 1:10565630-10565652 AATCTCCTAATCCTAAGAAAGGG - Intronic
901644948 1:10711678-10711700 AGTGTCCATGGACTGAGAAATGG + Intronic
901911015 1:12458268-12458290 AATCCCCTTGATGTAAGAAATGG + Intronic
902761385 1:18583039-18583061 CATCTCCATGGACTTAGAACCGG + Intergenic
906482212 1:46206491-46206513 AATCTCCTTGGAAGGAGAATTGG + Intronic
909273358 1:73652821-73652843 GATCTCATTGGACGAAGCAAAGG - Intergenic
916712171 1:167421339-167421361 AATCTCCTTGGACTAAGAAATGG - Exonic
916943094 1:169696683-169696705 AATCTCCTTTGACACAGATAGGG - Intronic
918783393 1:188732041-188732063 ACTTTCCTTGGAAAAAGAAATGG - Intergenic
922210557 1:223483449-223483471 TATCTCTTTGGAAAAAGAAAAGG - Intergenic
922368049 1:224884492-224884514 AATCTCCTTGGAAAGAGAAGGGG + Intergenic
923276926 1:232404595-232404617 AATGTCCTTGTGCTAAGATAAGG - Intronic
1063212956 10:3898010-3898032 AATCTCCTTTAAAAAAGAAATGG - Intergenic
1065563379 10:26985445-26985467 AATCTACTTGGAAACAGAAAGGG - Intergenic
1065564403 10:26994493-26994515 AATCTACTTGGAAACAGAAAGGG - Intronic
1065697498 10:28393232-28393254 AATCTCCATTGACACAGAAAAGG + Intergenic
1066841773 10:39930689-39930711 AATCTGCTTGGTCTAAAGAAAGG - Intergenic
1073663260 10:105501324-105501346 AATCTAATTGGCCCAAGAAAAGG + Intergenic
1075452106 10:122558497-122558519 TCTTTCCTTGGACTAAGAGAAGG - Intergenic
1076284329 10:129278149-129278171 AATCTCCTCTGACTAAGGCAGGG + Intergenic
1078329525 11:10408206-10408228 AATTCCCTGGGACCAAGAAATGG - Intronic
1087095773 11:94316008-94316030 AACGTCCTTGGGCTAGGAAATGG - Intergenic
1087509355 11:99070268-99070290 AATCTCCTTGAGGGAAGAAAGGG - Intronic
1087647735 11:100827768-100827790 CATCTCCTTGGCCAGAGAAAAGG + Intronic
1087963516 11:104382415-104382437 AATCTCCATTGACTATGAAAAGG - Intergenic
1089907484 11:122056787-122056809 AATTTCCTTGGCCTAAGTAAAGG - Intergenic
1090478711 11:127048608-127048630 AAACTCCTCAGACTGAGAAATGG + Intergenic
1091229119 11:133976439-133976461 ATTCTCCTTGCAGTGAGAAACGG + Intergenic
1097405099 12:59179558-59179580 AATGTCCTTGAACTAGGCAAAGG + Intergenic
1099428662 12:82553935-82553957 ACTCTGCTTGGAGTAAGCAAAGG - Intergenic
1100107531 12:91194165-91194187 AACCTCCTACCACTAAGAAAAGG + Intergenic
1110240781 13:73264372-73264394 AAAATCCATGGATTAAGAAAGGG + Intergenic
1111874112 13:93871664-93871686 ATTCTTCTTGGACTAAAAAGTGG - Intronic
1117002468 14:51384688-51384710 AATACTCTTGGCCTAAGAAAAGG + Intergenic
1117998690 14:61502845-61502867 ACACTCCTTTGACAAAGAAATGG + Intronic
1119188387 14:72661344-72661366 AATCTCTTTGGCCTCTGAAAGGG - Exonic
1120888349 14:89469608-89469630 AAGCTCCTTGGAGTAGGAAATGG + Intronic
1124147139 15:27138420-27138442 TTTTTCCTTGGACTAAAAAATGG + Intronic
1124939144 15:34201737-34201759 TGTCTTCTTGGACTCAGAAATGG + Intronic
1128481589 15:68044865-68044887 AATCTCCTTTGATGAATAAATGG - Intergenic
1131469255 15:92682179-92682201 AATCTCCTTTCACTAAGGTAGGG - Intronic
1137816670 16:51404617-51404639 GAACTCCATGGACTGAGAAAAGG + Intergenic
1138856893 16:60705100-60705122 AATCTCCTTGGAAAAAAAGAGGG + Intergenic
1138977977 16:62230870-62230892 AATCTCCATGTCCTAAGAAAGGG + Intergenic
1139114997 16:63939850-63939872 AAACTCCCTGAACTAATAAATGG - Intergenic
1139258801 16:65571875-65571897 AATTTCCGTGGAAGAAGAAAAGG - Intergenic
1141157703 16:81608887-81608909 CATCTCTTTGGGCTAAGAGAAGG - Intronic
1143967201 17:10764543-10764565 GATCCACTTGGACTCAGAAAAGG + Intergenic
1148327544 17:46792195-46792217 AATCACCCTGGCCTAAGAGAAGG + Intronic
1149084935 17:52704969-52704991 CACCTCCTTTCACTAAGAAAGGG - Intergenic
1150042745 17:61880955-61880977 CATCTCCTTGTACTACAAAAGGG + Intronic
1150094457 17:62360866-62360888 TATCTCCATAGATTAAGAAAAGG + Intergenic
1152916974 17:83044479-83044501 AACCTCCTTAGCGTAAGAAATGG + Intronic
1155786574 18:29910096-29910118 AATATCTTTAGTCTAAGAAAGGG - Intergenic
1155850707 18:30770212-30770234 AGTCCCCTTTGACTAAGAATGGG + Intergenic
1155901413 18:31395680-31395702 AATTTCCTCAGACTAAGAGAAGG - Intronic
1158745447 18:60195191-60195213 AAGCTCCTGGGGCTAAGGAAGGG + Intergenic
1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG + Intronic
925071126 2:967390-967412 AATCTCATTAAACTAAGAGAAGG - Intronic
926932144 2:18051241-18051263 AACCTCCCTGGACCAAGCAATGG - Intronic
928266123 2:29813379-29813401 AATCTCTTAGCACTAAGAATGGG + Intronic
930907614 2:56591057-56591079 AATTTCCTTAATCTAAGAAAGGG + Intergenic
933330004 2:80881306-80881328 AATAGTCTTGGTCTAAGAAAAGG - Intergenic
939430441 2:142098806-142098828 AATCTCAATGGACTAAGCCATGG + Intronic
940227368 2:151413886-151413908 AATCCCTTTGGAGTAGGAAATGG + Intronic
940882769 2:158962964-158962986 AATCTTATTGGACAAAGAACAGG - Intergenic
944204952 2:197148529-197148551 AATATCCTTGGGCTAATCAAGGG - Intronic
946241239 2:218357297-218357319 ATTCTCCTGGGACTCAGAAAAGG + Intronic
947384676 2:229579150-229579172 ATTCTCCTTGGACATACAAAGGG - Intronic
947562937 2:231173668-231173690 AATTCCCTTGGATTATGAAAGGG - Intergenic
948510723 2:238462693-238462715 AATGTCCATGGACTGATAAATGG - Intergenic
1172411649 20:34728290-34728312 AATCTTCATATACTAAGAAAAGG - Intronic
1175520754 20:59601362-59601384 AATGTCCATGGACTGATAAATGG - Intronic
1175782533 20:61692018-61692040 AATTTCCTTGCTCTAAGACAAGG - Intronic
1175940273 20:62534576-62534598 AGTCTCCTAGGACTAAGATGGGG + Intergenic
1177576844 21:22968267-22968289 AATTTCCTTGGACAAAGAAATGG + Intergenic
1177698553 21:24606415-24606437 AATCTCCCTAGACAAAGACAAGG - Intergenic
1178597541 21:33968324-33968346 TATCTCCTTAGACACAGAAATGG - Intergenic
1180306484 22:11130812-11130834 TATGACCTTGGACTAAGAAAAGG + Intergenic
1180545003 22:16492995-16493017 TATGACCTTGGACTAAGAAAAGG + Intergenic
1181362621 22:22349777-22349799 AATCTCCTTGGCCTCACAAATGG - Intergenic
1181365394 22:22372567-22372589 AATCTCCTTGGCCTCACAAATGG - Intergenic
1183300546 22:37056968-37056990 AATCCCCTGGGCCTGAGAAATGG - Intronic
949203008 3:1403135-1403157 GATGTCCTTGGACAAAGACACGG + Intronic
949387442 3:3518895-3518917 AGTCTCCTGGGACTAAGTGATGG + Intergenic
952010549 3:28895939-28895961 TTTCTCCTTGGAGAAAGAAAAGG - Intergenic
956799776 3:72746519-72746541 AACCTCCATGAACAAAGAAAGGG + Intergenic
957418926 3:79943182-79943204 AATCTCAATAGACTCAGAAAAGG - Intergenic
958896459 3:99835217-99835239 AATCACCTTTGACCCAGAAAAGG + Intronic
965134288 3:164741612-164741634 AATCTACTTGGATCAAGGAATGG + Intergenic
968281105 3:197477359-197477381 AAGCTCTTTGGATTAAGAAATGG - Intergenic
971331644 4:25686363-25686385 AAATTCCTTGGACCAAGACAAGG - Intergenic
973941516 4:55915838-55915860 AATATCCTTGATCTGAGAAAAGG + Intergenic
974470978 4:62316945-62316967 AATCTCTCTGGACTAAGCCAAGG - Intergenic
975181488 4:71350917-71350939 AATTTCCTAGGAATAAGAAGTGG + Intronic
976361086 4:84178933-84178955 AATCTCCTGGCAGAAAGAAAGGG + Intergenic
977950791 4:102968417-102968439 TATGACCTTGGACTAAGCAAAGG + Intronic
978059494 4:104319687-104319709 TGTTTCCTTGGAGTAAGAAATGG - Intergenic
978836901 4:113161842-113161864 AATGTCCTAGGAATAAGGAAGGG - Intronic
979153373 4:117349717-117349739 AGTCTCCTAGGTCTAAGACAGGG + Intergenic
979271090 4:118762725-118762747 ACTCTACTTGGAATAATAAAAGG + Intronic
980042784 4:127958608-127958630 TATCTCCTTTGACTCAGAAGAGG - Intronic
980697565 4:136379478-136379500 AATCTCCCAGGATTAGGAAACGG + Intergenic
982161189 4:152571411-152571433 AATCTCACTGGCCCAAGAAAGGG - Intergenic
983278429 4:165648700-165648722 AATATTCTTAGAATAAGAAAGGG + Intergenic
983381888 4:167005798-167005820 AATCTCATTTGATAAAGAAAAGG + Intronic
984607027 4:181797102-181797124 AATCCCCATGTACAAAGAAAAGG - Intergenic
984933779 4:184871969-184871991 AAACTCCTTGGTCTAATAAGAGG + Intergenic
985898999 5:2772179-2772201 AGTCTCCTGGGACTGAGAGAAGG + Intergenic
987625356 5:20391830-20391852 AATCTCCATTGAATAAGAAGTGG + Intronic
988120119 5:26950994-26951016 ACACTCCTTGGAATAATAAAAGG + Intronic
990906477 5:60808722-60808744 AATTTTCTTTGACTAATAAATGG + Intronic
992125005 5:73630999-73631021 AATCTCTTTGGACTAAGTCCAGG - Intronic
999892073 5:155989039-155989061 AATCTCACTGGAGGAAGAAAAGG - Intronic
1002420452 5:179144806-179144828 AATCTTCTTGACCTAAGTAATGG + Intronic
1002870528 6:1163434-1163456 AATCTCTTGGGATTAGGAAAGGG + Intergenic
1004584422 6:16985929-16985951 ATTCCCTTTGGACTATGAAAAGG - Intergenic
1005227464 6:23659276-23659298 AATCTACTGTGGCTAAGAAAAGG + Intergenic
1006987399 6:38185022-38185044 ACTCTCCTTGGAATAAGGAGCGG + Intronic
1008297641 6:49797265-49797287 CACTTCCTTTGACTAAGAAAGGG + Intergenic
1008570422 6:52811443-52811465 AATATTCTTGGGCTATGAAAAGG - Intergenic
1008577776 6:52877922-52877944 AATATTCTTGGACTATGAAAAGG - Intronic
1009042574 6:58197107-58197129 AATTTCCTTAGAATTAGAAAGGG + Intergenic
1009218412 6:60951335-60951357 AATTTCCTTAGAATTAGAAAGGG + Intergenic
1009277165 6:61697798-61697820 AGTTTCCTTTGAGTAAGAAATGG - Intronic
1011254755 6:85408914-85408936 AATCTACTTGGAATATGGAAGGG - Intergenic
1014611195 6:123549240-123549262 TATCTCCTAGGACATAGAAAAGG - Intronic
1015746556 6:136516091-136516113 AATTTGCCTGGAGTAAGAAAGGG + Intronic
1017016514 6:150105510-150105532 AAACTCTTTGGACTTAGTAAAGG + Intergenic
1017533763 6:155324792-155324814 CATTTATTTGGACTAAGAAAAGG + Intergenic
1020918824 7:14234726-14234748 AATCTCATGGAACTTAGAAAAGG + Intronic
1023877738 7:44297745-44297767 AATCTCCAGGGACAAAAAAATGG + Intronic
1024948762 7:54836982-54837004 AAACACCCTGGCCTAAGAAATGG + Intergenic
1025032378 7:55568386-55568408 GATCTTCTTGGACTAGAAAAAGG - Intronic
1026190510 7:68122066-68122088 AAACTCCTTGGTCTAGCAAATGG - Intergenic
1026367286 7:69661379-69661401 AACCACCTTGGTCTATGAAATGG - Intronic
1027957526 7:84900164-84900186 AATATTCTTAAACTAAGAAATGG + Intergenic
1030278224 7:107743122-107743144 AAACTCCTGGGACCAAGAACTGG + Intergenic
1030543125 7:110858400-110858422 AAACTCCTTGGACTAGCAGAGGG + Intronic
1030972662 7:116079448-116079470 AAGCTCCTAGAACTAATAAATGG + Intronic
1031015023 7:116564852-116564874 AATCTCCATGGACTCAGATTAGG + Intergenic
1032004358 7:128288152-128288174 AATCTCCTTGGACTTTTAATTGG - Intergenic
1036679328 8:10859390-10859412 AATCTAATTGGAATAAAAAAAGG + Intergenic
1036824895 8:11968362-11968384 AACCTCCCTGGACTAGGGAAAGG - Intergenic
1037431579 8:18818862-18818884 AATCCCCTTGGACTGATAAATGG + Intronic
1038317661 8:26501479-26501501 AATCACCTTGAACTTGGAAATGG + Intronic
1040804539 8:51379079-51379101 AATCTCCATGGACAAAAAAATGG - Intronic
1041313775 8:56541267-56541289 GTTCTCCTTGGAAAAAGAAATGG - Intergenic
1041620535 8:59962738-59962760 AATCACCTTAGACTTGGAAATGG + Intergenic
1044216671 8:89620063-89620085 AACCTCATTGGACTAAGACATGG - Intergenic
1045723692 8:105144460-105144482 AATCCCCTTTGACTTAGAAAAGG + Intronic
1046184468 8:110694601-110694623 AACCTCCTTGAAGTATGAAAAGG + Intergenic
1048010962 8:130455770-130455792 AATCTACTTGGAGTGGGAAAAGG - Intergenic
1048066793 8:130978163-130978185 AATCTCTTTGGAATATGCAAGGG - Intronic
1048807768 8:138256319-138256341 AATCTCCTTTGACTCAGAAGGGG + Intronic
1055602378 9:77933283-77933305 AATCTCCTTAGCTAAAGAAAAGG + Intronic
1056081215 9:83095844-83095866 AATCTGGTTGCTCTAAGAAAAGG - Intergenic
1057940500 9:99278671-99278693 AACCTCCCTGGTCTGAGAAATGG + Intergenic
1058277403 9:103061521-103061543 AATCTCCTGGAACTAATAAATGG + Intergenic
1059781123 9:117528719-117528741 AATCACTTCGGACTAGGAAAAGG + Intergenic
1059845816 9:118275366-118275388 AATCAGCTTGGAGAAAGAAAAGG - Intergenic
1060139452 9:121195826-121195848 TATCTTCTTAGAATAAGAAAGGG - Intronic
1062256108 9:135622218-135622240 CATCTCCTTTGACTAAAAGAAGG - Intergenic
1186156452 X:6731417-6731439 AATCTCAGTGGACTAAAAACTGG + Intergenic
1187081438 X:15993275-15993297 TATCTCCTAGGACTATTAAAAGG - Intergenic
1188046873 X:25435561-25435583 ATTCCCCTTTGACTAAGAAATGG - Intergenic
1189531383 X:41887521-41887543 AATCACCTTGGATTTAAAAAGGG + Intronic
1190372568 X:49756858-49756880 AATCTCCTGGGCAAAAGAAAGGG + Intergenic
1194915943 X:99708734-99708756 AATCTACTTGGAGTGAAAAAAGG - Intergenic
1195865826 X:109431860-109431882 AAAGTCCTTTAACTAAGAAATGG + Intronic
1196075344 X:111569538-111569560 AGTCTCCTGGGACAAAGAACCGG - Intergenic
1198500985 X:137246272-137246294 AATCCCCTTGCACTATGATATGG + Intergenic
1198587008 X:138133185-138133207 TAACTCCTTGGAGAAAGAAAAGG + Intergenic