ID: 916712890

View in Genome Browser
Species Human (GRCh38)
Location 1:167427553-167427575
Sequence GTCCCACGAAACCACACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916712890_916712894 3 Left 916712890 1:167427553-167427575 CCCTCAGTGTGGTTTCGTGGGAC 0: 1
1: 0
2: 0
3: 6
4: 70
Right 916712894 1:167427579-167427601 GAGTAGCAGTAGTCTCCCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916712890 Original CRISPR GTCCCACGAAACCACACTGA GGG (reversed) Intergenic
900972074 1:5997243-5997265 GTCCCAGGAAACCACGCAGAAGG - Intronic
901191235 1:7411184-7411206 GCCCCTCCAAACCACAGTGATGG - Intronic
903307194 1:22421223-22421245 GTCCCACGAAATCAAACTGTTGG + Intergenic
910321111 1:85945450-85945472 GTCATACAAAACCACACTCAAGG - Intronic
913597462 1:120392698-120392720 GTCCCACCATTGCACACTGAGGG - Intergenic
913611149 1:120510969-120510991 CTCACAACAAACCACACTGAAGG + Intergenic
914089868 1:144486616-144486638 GTCCCACCATTGCACACTGAGGG + Intergenic
914247870 1:145899269-145899291 GTCCCTCTGAACCACACTGATGG + Exonic
914308742 1:146447600-146447622 GTCCCACCATTGCACACTGAGGG - Intergenic
914580041 1:149011270-149011292 CTCACAACAAACCACACTGAAGG - Intronic
914593367 1:149125531-149125553 GTCCCACCATTGCACACTGAGGG + Intergenic
915071487 1:153272546-153272568 GTCCCACTAGACCACAGTGGTGG - Intergenic
915879996 1:159659454-159659476 GGCCCCCGAACTCACACTGAAGG - Intergenic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
1073920493 10:108452628-108452650 GTACAACCACACCACACTGAAGG + Intergenic
1075850239 10:125580848-125580870 GTCCCAGGAAAGGACTCTGATGG - Intronic
1076685728 10:132197702-132197724 GTCCCACGAAGTCTCACTGTGGG - Intronic
1078307736 11:10207234-10207256 TTCCCACGAAACTACCCTTAAGG + Intronic
1089467209 11:118693003-118693025 TTCCCAAGAGACCCCACTGAAGG + Intergenic
1101129167 12:101671402-101671424 CTCCCATGAAACCAAACTAAAGG + Intronic
1106275126 13:28197300-28197322 GTTCCACCAAACCATATTGATGG - Exonic
1107173319 13:37369740-37369762 GTCCCACAAATCCAAATTGAAGG - Intergenic
1109011151 13:56946403-56946425 GTCCTCTGAAACCTCACTGATGG + Intergenic
1116803116 14:49464133-49464155 GGCCTTGGAAACCACACTGAGGG + Intergenic
1121484712 14:94305804-94305826 ATCCCACCAGACCACACAGAGGG - Intronic
1122344187 14:101048109-101048131 GTCCAAGGAAATCACACTGGTGG - Intergenic
1202860687 14_GL000225v1_random:79433-79455 GGCCCACGAAAGCCCCCTGAGGG + Intergenic
1134313994 16:13101492-13101514 GTGCCAGGTAACCAAACTGAAGG + Intronic
1138066741 16:53949300-53949322 GTCTCACCACTCCACACTGATGG + Intronic
1138925480 16:61585179-61585201 TTCCAAAGAAACCACAGTGAAGG - Intergenic
1142009244 16:87705367-87705389 CTCCCACGGTTCCACACTGAAGG + Intronic
1142969616 17:3602452-3602474 GACCCAGAAAACCACACTGATGG - Intergenic
1148196823 17:45720008-45720030 CTCCCAGGAAACCACAGTGTGGG + Intergenic
1148863029 17:50614391-50614413 CTCCCACGAAGCCACAGAGAAGG - Intronic
1151426736 17:74035574-74035596 ATCCCAAGGAACCACAGTGAAGG - Intergenic
1152185526 17:78854322-78854344 GCTTCAGGAAACCACACTGAGGG + Exonic
1152688767 17:81708002-81708024 GTCCCAGGATACCCCACTTAAGG - Intergenic
1155800763 18:30099884-30099906 GTCTGACCAAACCACACTCAGGG - Intergenic
1159640069 18:70853787-70853809 GTCCAACGTCACCACAATGAAGG + Intergenic
1160564520 18:79778792-79778814 GTCTGACTAAACCACACAGAAGG - Intergenic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
925881216 2:8354376-8354398 GTGCCACCAAACCCCTCTGACGG + Intergenic
930118053 2:47736817-47736839 GTCCCACACCACCACACTAAAGG + Intronic
942522586 2:176819663-176819685 ATCCCACTAAGCCACTCTGAGGG - Intergenic
948342712 2:237268292-237268314 GTCCCCCAAGACCCCACTGAAGG - Intergenic
948733989 2:239986932-239986954 ATCCCTCAAAACCACATTGAGGG + Intronic
1170060172 20:12250634-12250656 GTCCCAAGAAAACCAACTGATGG - Intergenic
1175613681 20:60373946-60373968 TTCCCATGAAAACACAGTGAAGG - Intergenic
1185010307 22:48309189-48309211 AGCCCAGGAATCCACACTGAAGG + Intergenic
949875539 3:8623942-8623964 ACCCCACGAGTCCACACTGACGG - Intronic
951710945 3:25584495-25584517 GGCCCAAGAAAAGACACTGATGG + Intronic
953799488 3:46011431-46011453 GTCCCTCCAAGCCACACTGATGG + Intergenic
955214648 3:56974931-56974953 TTCCCACGCACCGACACTGAGGG + Intronic
964189064 3:153980830-153980852 CTCACAGGAAGCCACACTGATGG + Intergenic
965550770 3:169962818-169962840 GTCCTAGGAAACCATACTTAAGG - Intergenic
968460736 4:723595-723617 GCCCCACACAACCAGACTGAAGG - Intronic
972400163 4:38694228-38694250 GTCTCAGGAAACCACATTGTAGG - Intronic
973777625 4:54257598-54257620 GACTCAAGAAGCCACACTGAGGG - Intronic
974322130 4:60364976-60364998 GTCCCACTACACAACATTGAGGG - Intergenic
982915896 4:161208924-161208946 GTGCCAAGAAAATACACTGAAGG + Intergenic
987737840 5:21868379-21868401 GTCTCAAGAAACCAAACTGTAGG + Intronic
1004516368 6:16325534-16325556 CTCCCATGAAACCACAATAAAGG + Intronic
1011637393 6:89387054-89387076 GACCTAGGAAACCTCACTGATGG - Intronic
1015490642 6:133821566-133821588 GTTCCAGGAAACCAGACAGAGGG + Intergenic
1016949205 6:149564473-149564495 GTCCAACAAACCCCCACTGAGGG + Intergenic
1020210850 7:6157215-6157237 GTGCAACGGAACCACACTGCAGG - Intronic
1024042572 7:45566744-45566766 GTCCCAAGAATCCACACTCAAGG + Intergenic
1029298909 7:99563085-99563107 ATCCCACGTAACCACACCCAGGG + Intronic
1036945694 8:13092528-13092550 GTCCCACAAAACCACAGCTACGG + Intronic
1038729907 8:30117467-30117489 GTACAATGAAACCAAACTGAAGG + Intronic
1056216455 9:84409651-84409673 AGACCACGAACCCACACTGAAGG + Intergenic
1060466629 9:123912697-123912719 CTCCACTGAAACCACACTGATGG - Intronic
1062592886 9:137281888-137281910 GTCCCAGGAGCCCACACAGAGGG + Exonic
1186778554 X:12890700-12890722 GTCCTACAAAACTGCACTGAGGG - Intergenic
1188348154 X:29093878-29093900 GTCCCAAGAAACCAAAGTGTAGG + Intronic
1189839484 X:45058537-45058559 TTCCCAAGTAACAACACTGAGGG - Intronic
1199587756 X:149434199-149434221 GACACACCAAACCACCCTGATGG + Intergenic