ID: 916712894

View in Genome Browser
Species Human (GRCh38)
Location 1:167427579-167427601
Sequence GAGTAGCAGTAGTCTCCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916712884_916712894 13 Left 916712884 1:167427543-167427565 CCCTCCCAGACCCTCAGTGTGGT 0: 1
1: 0
2: 4
3: 41
4: 336
Right 916712894 1:167427579-167427601 GAGTAGCAGTAGTCTCCCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 65
916712885_916712894 12 Left 916712885 1:167427544-167427566 CCTCCCAGACCCTCAGTGTGGTT 0: 1
1: 0
2: 0
3: 31
4: 296
Right 916712894 1:167427579-167427601 GAGTAGCAGTAGTCTCCCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 65
916712886_916712894 9 Left 916712886 1:167427547-167427569 CCCAGACCCTCAGTGTGGTTTCG 0: 1
1: 0
2: 1
3: 6
4: 93
Right 916712894 1:167427579-167427601 GAGTAGCAGTAGTCTCCCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 65
916712891_916712894 2 Left 916712891 1:167427554-167427576 CCTCAGTGTGGTTTCGTGGGACC 0: 1
1: 0
2: 0
3: 5
4: 147
Right 916712894 1:167427579-167427601 GAGTAGCAGTAGTCTCCCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 65
916712882_916712894 26 Left 916712882 1:167427530-167427552 CCACTGCATTTCTCCCTCCCAGA 0: 1
1: 0
2: 6
3: 66
4: 506
Right 916712894 1:167427579-167427601 GAGTAGCAGTAGTCTCCCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 65
916712890_916712894 3 Left 916712890 1:167427553-167427575 CCCTCAGTGTGGTTTCGTGGGAC 0: 1
1: 0
2: 0
3: 6
4: 70
Right 916712894 1:167427579-167427601 GAGTAGCAGTAGTCTCCCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 65
916712887_916712894 8 Left 916712887 1:167427548-167427570 CCAGACCCTCAGTGTGGTTTCGT 0: 1
1: 0
2: 0
3: 5
4: 144
Right 916712894 1:167427579-167427601 GAGTAGCAGTAGTCTCCCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916712894 Original CRISPR GAGTAGCAGTAGTCTCCCTC AGG Intergenic
914419753 1:147518569-147518591 AATCAGAAGTAGTCTCCCTCTGG - Intergenic
915081783 1:153357577-153357599 GAGGAGCAGCAGGCTCGCTCGGG + Intergenic
916712894 1:167427579-167427601 GAGTAGCAGTAGTCTCCCTCAGG + Intergenic
921909249 1:220528876-220528898 GAGTAACCGGAGCCTCCCTCGGG + Intronic
923119889 1:230979867-230979889 GAGTAGCAGGAGACTCCATAGGG - Intronic
923120083 1:230981772-230981794 GAGTAGCAGGAGACTCCATAGGG - Intronic
1063555448 10:7074839-7074861 GAGTAACTCTTGTCTCCCTCTGG - Intergenic
1064514844 10:16135843-16135865 GAGTTGCAGTAGAGACCCTCTGG - Intergenic
1069398579 10:68017197-68017219 GAGGAGCAGTGGGCTGCCTCTGG - Intronic
1073640405 10:105246916-105246938 CAGTAGCAGACGTCTCCTTCTGG + Intronic
1076008428 10:126967029-126967051 GGGTAGCACCAGCCTCCCTCTGG - Intronic
1076108330 10:127842420-127842442 GAGTGTCAGTAATCTTCCTCTGG + Intergenic
1092090879 12:5802794-5802816 AAGGAGCAGTAGTCTCTCCCTGG - Intronic
1096490962 12:52012823-52012845 GGGTAGCAGAACTATCCCTCTGG + Intronic
1097638014 12:62145589-62145611 GAAAAGCAGTAGCCTCCCTCTGG + Intronic
1103255681 12:119539684-119539706 GAGTGGCAGTTGTCTCTCACTGG + Intronic
1118250218 14:64152695-64152717 GAGAAGCAGTGTTCTCACTCAGG + Exonic
1121929649 14:97960828-97960850 GAATAGCAGTAGTCGTCTTCTGG - Intronic
1129061593 15:72864635-72864657 GAGAAGCCGTAGTCTCCAACGGG + Intergenic
1131485865 15:92820248-92820270 GGGTAGCAGTAGTCTCTAACTGG - Intergenic
1142065433 16:88059711-88059733 GAGTAGCACACGTCTCCGTCGGG - Intronic
1143044311 17:4064471-4064493 GAGCAGCCGGAGTCGCCCTCGGG + Exonic
1143285606 17:5786791-5786813 GAGCAGCAGTTGACTGCCTCAGG + Intronic
1147232749 17:39030979-39031001 GAGGAGCTGTAGTCTTCCTTGGG - Intergenic
1147659267 17:42108551-42108573 TAGTAGCATTATTCTCTCTCTGG - Intronic
1147921946 17:43923059-43923081 GAGGAGCTGTAGTCTTCCCCAGG + Intergenic
1155060334 18:22222840-22222862 GAGTAACAGTAGTTACGCTCAGG + Intergenic
1158727381 18:59985978-59986000 GAGTACCAGGAGTCTCACACAGG - Intergenic
1160477926 18:79209461-79209483 AAGCAGCTTTAGTCTCCCTCAGG - Intronic
1162584326 19:11549822-11549844 GAGCAGCAGCAGCCTCCCTTGGG - Exonic
1163730941 19:18948880-18948902 GACTAGGAATACTCTCCCTCTGG - Intergenic
1164720490 19:30428515-30428537 GAGTAGCAGTGGCCACCCTGTGG + Intronic
1168424415 19:56227397-56227419 GAGCAGCAGCAGGCGCCCTCTGG - Intronic
930806606 2:55496770-55496792 GAGTACCTGTAGACTCCCTGTGG + Intergenic
932334179 2:70920455-70920477 GAGTGGCAGCAGCCCCCCTCTGG + Intronic
932800880 2:74741365-74741387 GAGTGCCAGGAGTCTACCTCTGG + Intergenic
941265386 2:163355236-163355258 GAGCAGCAGTAGTTTCTCCCAGG + Intergenic
1173279373 20:41614872-41614894 GAGTAGGAGTGGTCTTCCTGGGG - Intronic
1174554756 20:51386137-51386159 AAATAGCCTTAGTCTCCCTCTGG - Intergenic
1175600171 20:60266636-60266658 GAGAAGCAGCTGTCTCCATCAGG - Intergenic
1183461263 22:37952409-37952431 GAGGAGCAGAAGTCTTCCTCGGG + Intronic
960422787 3:117468131-117468153 TAGTAGCAGGACTCTCCCGCAGG + Intergenic
964428816 3:156582184-156582206 GAGAAGCAGTAGTTTCCCAAAGG + Intergenic
968841627 4:3010927-3010949 AAGTAACAGTACTGTCCCTCTGG + Intronic
971910426 4:32789043-32789065 CAGTAGCAGGCTTCTCCCTCTGG + Intergenic
977372512 4:96157466-96157488 GAGAAGCAGAAGTCTCTCACAGG + Intergenic
978829108 4:113061341-113061363 GAGGAGCTTTAGTCTCCCACTGG - Intronic
982222652 4:153138141-153138163 GAGAAGCAGATTTCTCCCTCGGG - Intergenic
984033802 4:174639668-174639690 GAGTACCAGGTGTCTCCCTATGG + Exonic
986458072 5:7940457-7940479 GAGTAGCAGTAATGGCCCTGTGG + Intergenic
986636112 5:9823822-9823844 GAATAGAAGTTGTCTCCATCTGG + Intergenic
987230606 5:15889972-15889994 GACTATCAGAAATCTCCCTCCGG - Intronic
989570774 5:42944226-42944248 GAGTAGCCGCAGGCGCCCTCTGG + Intergenic
991863382 5:71033384-71033406 GAGTAACAGGAGTTTCTCTCAGG - Intergenic
992006435 5:72483050-72483072 AATTAGCAGTAGTCTTCCTTTGG + Intronic
998602667 5:143601157-143601179 AAATAGCAGTGGTATCCCTCTGG - Intergenic
1003635043 6:7824327-7824349 GAGTAGCAGGGGTCTCCGTCCGG + Intronic
1015341343 6:132104516-132104538 GAGTAGCAGTATTTTCTCCCAGG + Intergenic
1015719417 6:136225817-136225839 GAGAAGCAGTACTCACCTTCTGG + Intergenic
1018056664 6:160057749-160057771 GAGTAGCAATAGTCTTCTTAGGG + Intronic
1025239314 7:57257918-57257940 GGGTAGCAGTTGTCTACCTGTGG - Intergenic
1035063937 7:156091824-156091846 GAGAAGCAGTCATCTCCCTTGGG - Intergenic
1045456011 8:102379785-102379807 GAGTAGGAGAAGTCTTCCTCAGG - Intronic
1045831081 8:106461207-106461229 GAGTAAGAGTAGTCTCCCCTGGG + Intronic
1051693553 9:19743745-19743767 GAGAGGCAGTAGTGTGCCTCAGG - Intronic
1056615230 9:88159981-88160003 GAGTGGGAGAAGACTCCCTCAGG - Intergenic
1057492213 9:95529212-95529234 GAGAACCACTAGTCTCCATCTGG + Intergenic
1061361160 9:130143189-130143211 TGGTAGCCGTAGACTCCCTCAGG + Intergenic
1194195056 X:90882631-90882653 GAGTGGCATTTGTTTCCCTCTGG + Intergenic
1197616130 X:128693747-128693769 GAGTTGAAGTTGTATCCCTCTGG + Intergenic