ID: 916713936

View in Genome Browser
Species Human (GRCh38)
Location 1:167434588-167434610
Sequence GAGGTTGACCTTCCTATAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916713923_916713936 19 Left 916713923 1:167434546-167434568 CCCAGATCGACAATCAGGGTTCA 0: 1
1: 0
2: 0
3: 1
4: 46
Right 916713936 1:167434588-167434610 GAGGTTGACCTTCCTATAGGGGG 0: 1
1: 0
2: 0
3: 6
4: 68
916713924_916713936 18 Left 916713924 1:167434547-167434569 CCAGATCGACAATCAGGGTTCAG 0: 1
1: 0
2: 0
3: 2
4: 40
Right 916713936 1:167434588-167434610 GAGGTTGACCTTCCTATAGGGGG 0: 1
1: 0
2: 0
3: 6
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916713936 Original CRISPR GAGGTTGACCTTCCTATAGG GGG Intronic
907496353 1:54847437-54847459 CAGGTTGCCCTTCCTAAAGCAGG + Intergenic
908065144 1:60395031-60395053 GAGGCAGAGCTTCCTATATGTGG - Intergenic
916713936 1:167434588-167434610 GAGGTTGACCTTCCTATAGGGGG + Intronic
922950105 1:229551915-229551937 GAGGTGGACCTTTATATAGCAGG - Intronic
1062974339 10:1672462-1672484 GAGGTGGACCTTCCTGGCGGAGG - Intronic
1067395505 10:45913321-45913343 GAGATTGACTTTTCAATAGGGGG + Intergenic
1067863826 10:49882444-49882466 GAGATTGACTTTTCAATAGGGGG + Intronic
1074599452 10:114899044-114899066 GTGGTTGTCCATCCTCTAGGAGG - Intronic
1082769151 11:57192490-57192512 GAGGTTAACATCCCTATTGGTGG - Intergenic
1083387358 11:62321465-62321487 GCAGTTAACCTGCCTATAGGAGG + Intergenic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1087016663 11:93560707-93560729 GAGGTTGCCCTTCCCAGAGTGGG + Intergenic
1087892492 11:103551225-103551247 GTGGTTGACCTTCATGGAGGAGG + Intergenic
1093934226 12:24983814-24983836 GAGGTTGCCCTTCCTATCACAGG - Intergenic
1094762336 12:33548516-33548538 GAGATAGAGCTTCCTATAAGTGG - Intergenic
1094890405 12:34945066-34945088 GAGGTTAACCTTCCTTTTGATGG + Intergenic
1094922665 12:35467153-35467175 GAGGTTAACCTTCCTTTTGATGG + Intergenic
1094965681 12:36163984-36164006 GAGGTTAACCTTCCTTTTGATGG + Intergenic
1094971440 12:36256719-36256741 GAGGTTAACCTTCCTTTTGATGG + Intergenic
1099563710 12:84212878-84212900 GAAGTTTTCCTTCCTATATGGGG - Intergenic
1101655406 12:106715943-106715965 AAGGTTCACCTACCAATAGGTGG - Intronic
1107126049 13:36848117-36848139 AAGGTTGACATACCTATAGCTGG - Exonic
1118453188 14:65922796-65922818 GAGCTTGACCTTCCTTCCGGTGG + Intergenic
1122743731 14:103886181-103886203 GACATTGACCTGCCTAGAGGTGG + Intergenic
1135143113 16:19938388-19938410 GAGGTTCATCTTCCTCTTGGTGG + Intergenic
1135808385 16:25565254-25565276 AAGGATGACCTTCCTAGAGGTGG + Intergenic
1142297498 16:89235417-89235439 GAGGTTGACCACTCTGTAGGTGG + Exonic
1150103319 17:62442945-62442967 GTGATTGACCTTCCTCTAGAAGG + Intronic
1151284188 17:73098007-73098029 TAGGTTGAACTACCTTTAGGAGG + Intergenic
1151675648 17:75596066-75596088 GAGGGAGCACTTCCTATAGGAGG + Intergenic
1157429010 18:47608134-47608156 GCCTTTGACCTTGCTATAGGAGG - Intergenic
1158141429 18:54260201-54260223 GAGATTAGCCTTCCTACAGGAGG + Intergenic
1160727859 19:625473-625495 GAGGTTCACGTTCCTCTGGGAGG + Intronic
1168090426 19:54079505-54079527 CAGGTTGGCCTTCCTAATGGAGG + Intronic
933300355 2:80533668-80533690 CATGTTGACCTTCATATATGTGG - Intronic
936009220 2:108914616-108914638 AAGGTTGATCTTCTTTTAGGAGG - Intronic
944777073 2:202977822-202977844 GAGGTTTAACTTTATATAGGGGG - Intronic
1171900476 20:30851713-30851735 GTGGCTGACCTTCCTACAGAAGG - Intergenic
1176927353 21:14766346-14766368 GTGTCTGACCTTCCTGTAGGAGG + Intergenic
1180321207 22:11323047-11323069 GTGGCTGACCTTCCTACAGAAGG + Intergenic
1180333836 22:11557698-11557720 GTGGCTGACCTTCCTACAGAAGG - Intergenic
1183125089 22:35770199-35770221 AAGTTTGACTTTCCTATTGGAGG - Intronic
1184803572 22:46777131-46777153 GAGGCTGACCCTCCTGTTGGTGG + Intronic
1184833471 22:47006450-47006472 GAGGTTGACCGCCCTGTAGTTGG + Intronic
950572919 3:13813152-13813174 CAGGTTGACTTTCCTCCAGGTGG + Intergenic
952192560 3:31039202-31039224 GAGGTTTACCTTACCAGAGGTGG - Intergenic
956180216 3:66510536-66510558 GAATTTGACCTGCCTTTAGGAGG + Intergenic
956720752 3:72115418-72115440 GAGGTTGATCTCGCTCTAGGTGG - Intergenic
957731259 3:84140383-84140405 GAGGTTGATCTTGCTATAAGAGG + Intergenic
957816038 3:85298309-85298331 AAGTCTCACCTTCCTATAGGAGG - Intronic
968310710 3:197681144-197681166 CAGCTTGACCTTCCTATAGAGGG + Exonic
972517074 4:39818809-39818831 GCGGTTGACCTTCCTCTTGGAGG + Intergenic
976749601 4:88440738-88440760 CAGGTTGCCCTTTCTATTGGTGG + Intronic
982901206 4:161004511-161004533 GAGGTTGACCTTCGAAGAGGGGG + Intergenic
986188571 5:5470214-5470236 GAGGGTTACCTGCCTACAGGGGG + Intronic
996724205 5:126659645-126659667 GAAGTTGGCTTTCCTTTAGGTGG + Intergenic
998185635 5:139977295-139977317 GAAGTTGTCCTTGCTATAGAGGG + Intronic
998668763 5:144329901-144329923 GAGGTTGAAATTCTCATAGGTGG + Intronic
1005242781 6:23851689-23851711 GAAGGTGACCTTTCTATAGGTGG + Intergenic
1013307241 6:108860701-108860723 GAGGTTGGTCAACCTATAGGTGG + Intronic
1019054018 6:169207430-169207452 GACTTTGACCTTCCTATACCTGG - Intergenic
1019891779 7:3953029-3953051 GAGATTCTCCTTCCTAGAGGCGG - Intronic
1019980234 7:4616016-4616038 AAGGTTCACCTCCCTCTAGGGGG + Intergenic
1020218301 7:6213075-6213097 GGAGTTGACATTCTTATAGGAGG - Intronic
1027436281 7:78167944-78167966 GAGGTTGACCTGCCCATTGCGGG + Exonic
1032032507 7:128496117-128496139 GTGATTGACCTTCCTCTAGAAGG + Intronic
1047534704 8:125708938-125708960 CAGGTTGACCTACCTACAGTTGG - Intergenic
1048268552 8:133009441-133009463 GAGGTTTACCTTCCTCTTGCCGG + Intronic
1050436537 9:5616530-5616552 AAGGTTGACATTTCTTTAGGAGG - Intergenic
1055003398 9:71479213-71479235 CAGGTTGACCTGCATATAGTAGG - Intergenic
1056829161 9:89900447-89900469 GAGGTTTACTTTCCAGTAGGAGG + Intergenic
1060452214 9:123753744-123753766 AGAGTTGACCTTCCAATAGGAGG + Intronic
1195073489 X:101303860-101303882 GATGTTGGCCTTCCTATACCTGG + Intergenic
1198392069 X:136186296-136186318 GAGGGTAACCTTCATATAGCTGG + Intronic
1201068860 Y:10126140-10126162 GTGGCTGACCTTCCTACAGAAGG - Intergenic