ID: 916714459

View in Genome Browser
Species Human (GRCh38)
Location 1:167437747-167437769
Sequence GTACAAAGCCTCAATTAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 6, 2: 28, 3: 99, 4: 412}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916714453_916714459 22 Left 916714453 1:167437702-167437724 CCAGAGGCTGGGGAATGGGGGGA 0: 1
1: 2
2: 22
3: 246
4: 1461
Right 916714459 1:167437747-167437769 GTACAAAGCCTCAATTAGATAGG 0: 1
1: 6
2: 28
3: 99
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916714459 Original CRISPR GTACAAAGCCTCAATTAGAT AGG Intronic
900758339 1:4453483-4453505 GTGCAAAGTCACAATCAGATAGG + Intergenic
900901230 1:5517441-5517463 ATACAAAGTCTCAGTTAGACTGG + Intergenic
902640996 1:17766087-17766109 TTTCAAAGCCTCAATTACAAGGG - Intronic
904859606 1:33525581-33525603 GTACAAAGTTTCCATTAGACTGG + Intronic
906761099 1:48379508-48379530 GTACAAAGTTTCAAGTAGACAGG + Intronic
907086927 1:51683958-51683980 GTACAAAGTTTCAGTTAGACAGG + Intronic
908341351 1:63182867-63182889 ATACAAAATTTCAATTAGATGGG + Intergenic
908909755 1:69059584-69059606 TTTCAAAGACTCAATTTGATGGG + Intergenic
909064404 1:70917133-70917155 GTACAAAGTTACAATTAGACAGG - Intronic
909516441 1:76512670-76512692 GTACAAAGTTACAATTAGACAGG - Intronic
909742136 1:79042914-79042936 GTACAAAGCCTCAGTAAGGAGGG + Intergenic
909825641 1:80123368-80123390 GTAAAAAGCATCAATAAGACAGG - Intergenic
911364250 1:96917482-96917504 CTACAAAGTTTCAATTAGACAGG + Intergenic
911499627 1:98669015-98669037 GTGGAAAGTCTTAATTAGATGGG + Intronic
912526079 1:110283717-110283739 TTACAAAGCATCATTTAGAGTGG + Intergenic
912583485 1:110740236-110740258 GCACAAAGTCACAATTAGATGGG + Intergenic
912831977 1:112961031-112961053 GTACAAAGTGACAATTAGATTGG - Intergenic
913120796 1:115738832-115738854 GTGCAAAGCCTCAATTAGACAGG - Intronic
913470855 1:119184220-119184242 GTACAAAGCCTCAGTTGAACAGG - Intergenic
915518591 1:156428499-156428521 ACACAAACCCTCCATTAGATGGG + Intronic
915774632 1:158469381-158469403 GTACAAAATTTCAGTTAGATAGG - Intergenic
915783782 1:158584380-158584402 GTACAAAGATATAATTAGATGGG + Intergenic
916621690 1:166504754-166504776 GTACAAAGTTACAATTAGAAAGG + Intergenic
916714459 1:167437747-167437769 GTACAAAGCCTCAATTAGATAGG + Intronic
916805728 1:168259227-168259249 ATACAAAGTTTCAGTTAGATAGG - Intergenic
917257186 1:173128379-173128401 GTACAAAGCCTCCTTTATTTAGG - Intergenic
917341637 1:173985734-173985756 ATACAAAGCTTCAGTTAGACTGG - Intronic
918191205 1:182176369-182176391 GTACAAAGTTTCAGTTAGACAGG - Intergenic
918503289 1:185222883-185222905 GTACAAAGTTACAATTAGATAGG - Intronic
918578736 1:186099043-186099065 GTACAAAGTTACAATTAGAAAGG + Intronic
918676154 1:187288716-187288738 GTACAAAGTTCCAGTTAGATAGG - Intergenic
918870971 1:189974410-189974432 GTACAAAAAGTCTATTAGATCGG - Intergenic
920025734 1:202994137-202994159 GTACAAAGCTGTAGTTAGATAGG - Intergenic
920944762 1:210518193-210518215 GTACAAAGTTTCAATTAGATAGG - Intronic
920995954 1:210991489-210991511 GTACAAAGTTTCAGTTAGACAGG + Intronic
924070293 1:240270876-240270898 GTACAAAGTCTCATTTAGATAGG + Intronic
924355356 1:243168673-243168695 GTACAAAATCTCACTTAGACAGG - Intronic
924589076 1:245386363-245386385 GTACAAAGCCTCAGTTAGATAGG - Intronic
924791471 1:247254057-247254079 GCACAAAATCTCAGTTAGATTGG - Intergenic
1063076985 10:2727153-2727175 GTACAAACATTCAGTTAGATGGG - Intergenic
1063641171 10:7832143-7832165 GTACAAAGCCTCAATCTGACAGG - Intronic
1063740641 10:8815100-8815122 GTACAAAATTTCACTTAGATAGG - Intergenic
1065248121 10:23780379-23780401 GTACAAAGTTTCAGTTATATAGG - Intronic
1065269977 10:24019077-24019099 GTACAAAGTTTCAGTTAGACAGG + Intronic
1065705323 10:28466905-28466927 GTACAAAGTTACAATTAGATAGG + Intergenic
1067498354 10:46778939-46778961 GCACAAAGCCTCAATTAGACAGG + Intergenic
1067596293 10:47561476-47561498 GCACAAAGCCTCAATTAGACAGG - Intergenic
1067761728 10:49053562-49053584 GAGCATAGCCTAAATTAGATGGG + Intronic
1067827228 10:49585624-49585646 GTACAAAGTTACAGTTAGATTGG + Intergenic
1068439733 10:57036422-57036444 GTACCAAGTCACAATTAGAAAGG - Intergenic
1068777590 10:60884870-60884892 ATACAAAGTTTCACTTAGATGGG + Intronic
1069328923 10:67266694-67266716 GTACAAAGTTTCAGCTAGATAGG + Intronic
1071078900 10:81785706-81785728 GTACCAAATCTCAATTAGACAGG - Intergenic
1071383285 10:85093337-85093359 GTACAAAGTTTCAATCAGACTGG - Intergenic
1073665499 10:105528193-105528215 GTACAAAGTTTCAGTTAGATTGG + Intergenic
1073997348 10:109330925-109330947 GTACAAAGCTACAGTTAGAGAGG - Intergenic
1074203863 10:111264238-111264260 GTACAAAGTTTCAACTAGATGGG - Intergenic
1074433318 10:113411925-113411947 GTACAAAGCCTTAATTAGAAAGG + Intergenic
1074683784 10:115938889-115938911 GTACAAAGTTTCAGTTAGACTGG + Intronic
1074737878 10:116454528-116454550 GTACAAAGCTTCAGTTACACAGG - Intronic
1075480058 10:122772541-122772563 GTACAAAGTTTCAGTTAGATAGG - Intergenic
1078519939 11:12054809-12054831 GTACAAAGTTTCAATTATACAGG - Intergenic
1078870282 11:15337008-15337030 ATTCAAAGCCTCAGTTGGATGGG - Intergenic
1079179991 11:18183628-18183650 GTATAAAACCTTAATTAAATAGG - Intronic
1079254333 11:18813804-18813826 GTACAAAGCTTCAGTTGGACTGG - Intergenic
1079274741 11:19024736-19024758 GTACAAAGTTTCAGTAAGATGGG - Intergenic
1079706148 11:23621765-23621787 GTACAAAGCCCCAGTTAGGAGGG - Intergenic
1079839524 11:25378851-25378873 GTTCAAAGCCACAGTTAAATAGG - Intergenic
1079954091 11:26841302-26841324 GCACAAAGTTTCAGTTAGATAGG + Intergenic
1080174567 11:29346435-29346457 ATACAAAGTTTCAGTTAGATAGG + Intergenic
1080923501 11:36732147-36732169 GAACAAAGCCTCAATAAGTTTGG + Intergenic
1081050251 11:38331286-38331308 GTACAAAGATTTGATTAGATTGG + Intergenic
1081902210 11:46638537-46638559 GTACAAGGCCACAGTTAGATAGG - Intronic
1082682648 11:56195572-56195594 GTACAAAGTTTCAATTAGAGAGG + Intergenic
1083014142 11:59435071-59435093 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1083489176 11:63002478-63002500 GTACAAAGTTTCAGCTAGATGGG - Intronic
1083914921 11:65735713-65735735 GTACAAAGTTTCAGTTAGACAGG - Intergenic
1084078387 11:66800268-66800290 GTACAAAGTTTCAGTTAGACAGG + Intronic
1084842883 11:71871408-71871430 GTACAAAGCCTCAACTGGACAGG + Intronic
1086019451 11:82208948-82208970 ATACAAAATCTCAGTTAGATAGG + Intergenic
1088441312 11:109873977-109873999 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1088443611 11:109899987-109900009 TTACAAAGCCACAGTTAGGTAGG + Intergenic
1088547781 11:110978298-110978320 GTACAAAGTTACAGTTAGATAGG + Intergenic
1088584498 11:111350026-111350048 GTACAAAGTCTTAGTTAGAAAGG + Intergenic
1090310998 11:125739386-125739408 GTACAAAGTTTCAAGTAAATAGG + Intergenic
1090722023 11:129484301-129484323 GTACAAAGTGTCAGTTAGACAGG - Intergenic
1092759913 12:11800515-11800537 ATACAAAACGTCAGTTAGATGGG - Intronic
1093509788 12:19913019-19913041 GTACAAAGTTTCAGTTAGACTGG - Intergenic
1093721339 12:22445459-22445481 ATACAAAACTTCAATTAAATAGG + Intergenic
1093982924 12:25494951-25494973 GTACAAAGCTTCAGTTAAACAGG - Intronic
1094417057 12:30228354-30228376 GTCCAAAGTTTCAGTTAGATAGG - Intergenic
1095361316 12:41343621-41343643 GTACAATGTTGCAATTAGATAGG + Intronic
1097676686 12:62610623-62610645 GTACAAAGTTTCAGTTAGACAGG - Intergenic
1097836521 12:64278704-64278726 GTACAAAACTTCAGTTAGACAGG - Intronic
1097976059 12:65687680-65687702 GTACAAAGCTACAATTAAATAGG + Intergenic
1098089559 12:66886297-66886319 CTTAAAAGCCTCAATTATATAGG - Intergenic
1098518584 12:71408654-71408676 GTACAAAGCTTCAGTTAGGCAGG + Intronic
1098531736 12:71549328-71549350 GTACAAAGCTTCAGTTAGACAGG + Intronic
1098569945 12:71977005-71977027 GTACAAAGTTGCAGTTAGATAGG + Intronic
1099950753 12:89300170-89300192 GTACAAAGTTACAGTTAGATAGG + Intergenic
1100100540 12:91098670-91098692 GTACAAAGTTTCAATTAGACAGG + Intergenic
1100268501 12:93001166-93001188 GTATACAGCCTCAGTTAGACAGG - Intergenic
1100666113 12:96755426-96755448 GTACAAAGTTTCAGTTAAATGGG - Intronic
1101042058 12:100765981-100766003 GTACAAAATTTCAATTAGATAGG - Intronic
1103047367 12:117748327-117748349 GTACAAAGTTTCAGTTAGATAGG + Intronic
1103696835 12:122822463-122822485 GTACAAAGTTTCAATTAGACAGG - Intronic
1105689201 13:22818954-22818976 GTACAAAGTTACAATTTGATAGG - Intergenic
1105816975 13:24044934-24044956 GTACAAAGTTACAGTTAGATAGG + Intronic
1106020713 13:25912420-25912442 GTACAGAGCCTCAGTGAGACAGG + Intronic
1106644765 13:31620699-31620721 GTACAAAGGTACAATTAGATAGG - Intergenic
1106689685 13:32101067-32101089 GTACAGAGTTTCATTTAGATAGG - Intronic
1107106966 13:36654319-36654341 GTACAAAGTTACAATTAGAAAGG - Intergenic
1107177772 13:37419800-37419822 GTACAAAGTTTCAGTTAGACTGG + Intergenic
1107210474 13:37847916-37847938 GTACAAAGTTTCAGATAGATAGG + Intronic
1108272789 13:48778786-48778808 ATACAAAGCCTCATTTAGACAGG - Intergenic
1108785012 13:53889409-53889431 ATACAAAGTATCAATTAGACAGG - Intergenic
1109015607 13:57008793-57008815 GTACAAATCTTCAGTTAGATAGG + Intergenic
1109084778 13:57955965-57955987 GTGCAAAGCCCCAATTAGACAGG - Intergenic
1109174593 13:59139448-59139470 ATACAAAGCATCAAATAAATAGG - Intergenic
1109479884 13:62937199-62937221 GTACAAAGTTACAATTAGACAGG + Intergenic
1109615113 13:64823794-64823816 GTACAATGTTACAATTAGATAGG + Intergenic
1109648107 13:65287645-65287667 GTATAAAGTTGCAATTAGATAGG - Intergenic
1109660222 13:65448013-65448035 ATATAAAGCCTCAATTAGATAGG + Intergenic
1109662493 13:65482293-65482315 GTACAAAGTTTCAGTTAGAGAGG - Intergenic
1110162391 13:72394228-72394250 ATACAAAATTTCAATTAGATAGG + Intergenic
1110192188 13:72743045-72743067 GTACAAAGTTTCAGTTAGACAGG + Intronic
1110952143 13:81508706-81508728 GTACCAAGATACAATTAGATAGG - Intergenic
1110952206 13:81509722-81509744 GTACAAAGATACAATTAGATAGG + Intergenic
1111178533 13:84631384-84631406 GCACAAAGCCTCAGTTAGATTGG - Intergenic
1111309283 13:86460526-86460548 GTACAAAGTTTCAGTTAGACTGG + Intergenic
1111602365 13:90491157-90491179 GTACAAAGTTACAATTAAATAGG - Intergenic
1112095893 13:96131653-96131675 ATACAAAATTTCAATTAGATGGG - Intronic
1112683342 13:101793128-101793150 ATACAAAGCCTCAGTTAGATAGG - Intronic
1112685874 13:101825713-101825735 TTACAAAACCTAAAGTAGATGGG + Intronic
1114340920 14:21742903-21742925 TTACAAAGCCACACTTAGTTAGG + Intergenic
1115058046 14:29154838-29154860 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1116024640 14:39500255-39500277 GTACAAAGTTACAATTAGATAGG - Intergenic
1116316691 14:43405377-43405399 GTACAAAGTTACAGTTAGATAGG + Intergenic
1116722763 14:48521606-48521628 ATACAAAATTTCAATTAGATAGG + Intergenic
1117570916 14:57048466-57048488 GTACAAAGTTTCAGTTAGATAGG - Intergenic
1117967261 14:61218821-61218843 TTACAAAGCCTCAGTTAGGTGGG - Intronic
1118160145 14:63280414-63280436 GTACAAAGCTGCAGTTAGCTAGG + Intronic
1119475855 14:74927688-74927710 GTGCAGAGCCTCAATTAGCCTGG + Intergenic
1120312632 14:82850280-82850302 GTACAAAGTTACAATTAGAAAGG + Intergenic
1120623061 14:86790186-86790208 GTACAAAGTTTCAGTTTGATAGG - Intergenic
1121487916 14:94332726-94332748 GTACAAAGTATCAGTTAGACAGG - Intergenic
1123101980 14:105810079-105810101 GTACAAAGTCTCAGGTAGACAGG - Intergenic
1123779558 15:23612807-23612829 GTATCAAGCCTCATTTAGATTGG + Intronic
1123884508 15:24711583-24711605 GTACAAAGCTTTGGTTAGATAGG + Intergenic
1123896068 15:24831579-24831601 GTACAAAATTTCAGTTAGATAGG - Intronic
1123978036 15:25571056-25571078 GTACAAAGTTTCAGTTACATAGG + Intergenic
1124049093 15:26178539-26178561 GTACAAAGCTCCAGTTAGACTGG + Intergenic
1124385324 15:29203699-29203721 GTACAAAATTTCAGTTAGATTGG - Intronic
1125446339 15:39761599-39761621 GTACAAAGTCTCAGTTAGACAGG + Intronic
1125568755 15:40698060-40698082 GCACAAAGTTTCAGTTAGATAGG - Intronic
1126305606 15:47252501-47252523 GTACAAAGTAACAGTTAGATAGG - Intronic
1126442570 15:48706491-48706513 GTACAAAGTTACAATAAGATAGG - Intergenic
1129549049 15:76428679-76428701 GTACAAGGCTACAATTAAATAGG + Intronic
1129555103 15:76500076-76500098 TAACAGAGCCTCAATTAAATGGG - Intronic
1129962622 15:79701347-79701369 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1130570608 15:85039979-85040001 GCACAAAGTTTCATTTAGATAGG + Intronic
1130798646 15:87237503-87237525 GTACAAAGCTACAGTTAGACAGG - Intergenic
1131163306 15:90124011-90124033 GTACAAATCCTCAATTAGACAGG - Intergenic
1132402012 15:101516663-101516685 GTACAAAGCCTCAGTTAGACAGG - Intronic
1133665169 16:7960076-7960098 GCACAAAGTTTCAATTGGATAGG + Intergenic
1133666804 16:7976190-7976212 GTACAAAGTTTCACTTAGACAGG + Intergenic
1134030996 16:10992221-10992243 GTACAAAGTTCCAATTAGACAGG - Intronic
1134208338 16:12255492-12255514 GTACAAAGCTTCAGTTGGACAGG - Intronic
1135774920 16:25249174-25249196 GTACAAAATTTCAGTTAGATGGG + Intronic
1135886525 16:26314536-26314558 GTACAAAGTCACAGTCAGATAGG - Intergenic
1135928944 16:26720208-26720230 GTACAAAGACTCAGTTCAATAGG + Intergenic
1137329240 16:47473972-47473994 GTACAAAGTTTCAGTTAGATAGG - Intronic
1137396721 16:48121060-48121082 GTACAAAGTTTCAATTAGACAGG - Intronic
1138048071 16:53746811-53746833 GTACAAAGCCTCAATTAGACAGG - Intronic
1138581535 16:57944417-57944439 GTACAAAGATTCAGCTAGATAGG + Intronic
1138753527 16:59454006-59454028 GTGCAATTCCTCAATTAGAGAGG + Intergenic
1139405625 16:66715367-66715389 GTATAAAGTGACAATTAGATAGG + Intergenic
1139769555 16:69263015-69263037 GTACAAAGTTTCAATTAAACAGG - Intronic
1140286833 16:73610964-73610986 TGACAAAGCCTCCATCAGATAGG - Intergenic
1141299829 16:82803842-82803864 GTATAAAGCATCAATTATATGGG + Intronic
1141710063 16:85693456-85693478 GTACAAAGTCTCAGTTAGACAGG - Intronic
1203144064 16_KI270728v1_random:1788053-1788075 GTACAAAGTTACAATTAAATAGG + Intergenic
1144228590 17:13176002-13176024 GTACAAAGTTACAACTAGATAGG + Intergenic
1144597011 17:16578648-16578670 GTACAAAGTTTCAGTTAGACAGG - Intergenic
1146095381 17:29925334-29925356 GTACAAAGTTTCCATTAGACAGG + Intronic
1147412389 17:40263098-40263120 GTACAAAGTTTCAGTTAGACAGG + Intronic
1149283149 17:55130629-55130651 GTACAAAGTTTCAGTTACATAGG - Intronic
1149945862 17:60926020-60926042 GTACAAAGTCTCAGTTAAAACGG - Intronic
1150524015 17:65902696-65902718 GTAAAAAGCAGCAATTAAATCGG + Intronic
1150985251 17:70188920-70188942 GTACAAAGTTACAATTAGATAGG - Intergenic
1153369738 18:4301246-4301268 GCACAAAGCCTCAGTTAGATAGG - Intronic
1155598996 18:27522263-27522285 GTACAAAGTTTCAGTTAGATGGG - Intergenic
1155715996 18:28944615-28944637 GTACAAAGTTTCAGTTAGACAGG - Intergenic
1156440188 18:37178157-37178179 GTACAAAGTTACAGTTAGATAGG - Intronic
1156812711 18:41272315-41272337 GTACAAAGCTACAGTTAAATAGG + Intergenic
1157638985 18:49192934-49192956 GTACAAAGCCCCAGTTAGGCAGG + Intronic
1159235603 18:65669037-65669059 GTACAAAGCCACAATTATGCAGG - Intergenic
1159331893 18:67005595-67005617 ATACAAAGATACAATTAGATCGG - Intergenic
1159334700 18:67047282-67047304 GTACAAAGTCACAGTTAGATAGG - Intergenic
1159343990 18:67174815-67174837 ATACAAAGTTTCAGTTAGATAGG + Intergenic
1159749388 18:72281531-72281553 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1160093952 18:75853222-75853244 ATACAAAATTTCAATTAGATAGG + Intergenic
1160343988 18:78114745-78114767 GTACAAAGTCACAGTTGGATAGG - Intergenic
1162627952 19:11900718-11900740 GTACAAATCCTTGATCAGATAGG + Intronic
1163099469 19:15085641-15085663 ATACAAAATTTCAATTAGATGGG - Intergenic
1165251030 19:34534431-34534453 ATACACAACCTCAGTTAGATGGG - Intergenic
928349002 2:30529819-30529841 TTGCAAAGCCTCAAGTAGCTAGG + Intronic
930419917 2:51137607-51137629 GTACAAAGTTAAAATTAGATAGG + Intergenic
931116084 2:59168322-59168344 GTTGAAAGCCTTAATTACATTGG + Intergenic
931472288 2:62550686-62550708 GTATAAAGTCTCAGTTAGAGAGG - Intergenic
932941885 2:76176747-76176769 GTACAAAGTCACAATTAGAGAGG - Intergenic
933009468 2:77041027-77041049 GTACAAAGGTACAGTTAGATAGG - Intronic
933419976 2:82032279-82032301 GTACAAAAATTCAGTTAGATAGG + Intergenic
934016947 2:87898229-87898251 GTACACAGCCTTTATTAAATAGG - Intergenic
935208718 2:100920183-100920205 GTAGAAAGCTTCAGTTAGACAGG + Intronic
935378695 2:102426858-102426880 GTACAAAGTTTCAGATAGATGGG - Intronic
936907156 2:117550083-117550105 GTACAAAGTGTCAATTAGAAAGG + Intergenic
937618666 2:123959171-123959193 TTACAAAGCCTCAGTTATACAGG - Intergenic
937625405 2:124037714-124037736 GTACAAAGTTTCACTTAGAAAGG + Intronic
939182544 2:138820859-138820881 GTACAAAGCGTCAGTTAGAAAGG + Intergenic
939436764 2:142186916-142186938 GTACAAAGTCACAATAAGATAGG - Intergenic
939620891 2:144417724-144417746 GTACAAAACTACAGTTAGATAGG + Intronic
940592377 2:155746131-155746153 GTATAAAGCCTTAATTAGATAGG + Intergenic
940714858 2:157209889-157209911 GTACAAATCCACAATTATAGTGG - Intergenic
941338674 2:164277934-164277956 GTACAAAGTAACAATTAGATTGG - Intergenic
941680229 2:168390199-168390221 GTACAAAGTTTCTATTACATAGG + Intergenic
942309184 2:174638506-174638528 GTACAAAGTTACAATTAGACAGG - Intronic
942863625 2:180646252-180646274 GTACAAAGTTTCAGTTAGATAGG - Intergenic
942909161 2:181220858-181220880 GTATAAAGTTTCAGTTAGATAGG - Intergenic
943550215 2:189329356-189329378 GCACAAAGTTTCAGTTAGATAGG + Intergenic
944118507 2:196214472-196214494 GTAAAAAGCCTTATTCAGATAGG + Intronic
944590362 2:201211340-201211362 GTACAAAGTTACAATTAGATAGG - Intronic
944603954 2:201332669-201332691 GTACAAAATCTCAATTAGGCAGG - Intronic
945768708 2:214013441-214013463 GTACAAAGTTACAATTAGATAGG - Intronic
945853819 2:215042803-215042825 GTAGAAAGTTACAATTAGATAGG - Intronic
945954198 2:216070407-216070429 GTACAAAGTTTCATTTAGACAGG - Intronic
946137535 2:217659949-217659971 GTACAAAGTTTCAGTTAGACAGG + Intronic
946623438 2:221584776-221584798 GTACAAAATCTCAGTTAGACAGG - Intergenic
947877715 2:233478888-233478910 GTACACAGCCTCTCCTAGATGGG - Intronic
948045687 2:234942039-234942061 GTACAAAGCCTCAGTTAGACAGG - Intergenic
948958117 2:241310301-241310323 GTACAAAACATCAATTAGACAGG + Intronic
1168983608 20:2028158-2028180 ATATAAAGTTTCAATTAGATAGG - Intergenic
1169250078 20:4053585-4053607 GTACAAAGTGACAATTAGATTGG + Intergenic
1169293597 20:4373664-4373686 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1169706456 20:8511092-8511114 GTACAAAGTTTCAGTTAGACAGG - Intronic
1170386817 20:15828014-15828036 GTACAATGCTTCAGTTAGACAGG + Intronic
1171089456 20:22270164-22270186 ATACAAAGTGTCAATTTGATTGG - Intergenic
1172989164 20:39019827-39019849 GTACAAAGTTTCAGTTAGACTGG - Intronic
1173642189 20:44611412-44611434 GTACATAGTTACAATTAGATAGG - Intronic
1177221218 21:18195415-18195437 GTACAAAGTTTCAGTTAGAAAGG - Intronic
1177230423 21:18313153-18313175 GTACAGAGCTTCATTTAGACAGG + Intronic
1177747143 21:25230670-25230692 GTACAAAGTTTCATTTAGACAGG + Intergenic
1178433720 21:32538631-32538653 GAACAAAGCTACAATTAGAAAGG + Intergenic
1179263507 21:39779931-39779953 GTACAAAGTTTCAATTAGACAGG + Intronic
1180246295 21:46550235-46550257 GCACAAAGCCTCAATTAGACAGG - Intronic
1182166238 22:28176455-28176477 GTACAAAGTTACAATTAGATGGG + Intronic
1182248122 22:28976898-28976920 TTACAAACCCTCACTTAGAATGG - Intronic
1182607135 22:31514546-31514568 ACACAAAGCCTCAGTTAAATAGG - Intronic
1182944774 22:34311613-34311635 GCACAAAGCTTCAATTAGACTGG + Intergenic
1184969967 22:48011803-48011825 GGACAAATCCTCTATTACATTGG - Intergenic
949298245 3:2552138-2552160 GCACCAAGCCTCACTTAAATGGG + Intronic
949863211 3:8525150-8525172 GTACAAAGTTTCAATTAGGCAGG - Intronic
951195798 3:19822138-19822160 GTACAAAGTTTTAATTACATAGG - Intergenic
951771210 3:26259592-26259614 GTGCAAAGGCTCAAATAAATAGG + Intergenic
952674904 3:36016846-36016868 GTACAAAGTCTCAGTTATGTAGG - Intergenic
953306790 3:41838955-41838977 GTACAAACCTTCAGTTAGACAGG + Intronic
953592417 3:44271859-44271881 GTACAAAACCTCAATTAAACAGG - Intronic
956496673 3:69834265-69834287 ATACAAAGTTACAATTAGATAGG - Intronic
958184378 3:90101574-90101596 GTACAAAGCCTCAAATAGACAGG - Intergenic
958186434 3:90126204-90126226 GTACAAAGTTACAATTAGATAGG - Intergenic
958525778 3:95257639-95257661 GTACAAAGTTTCAATTAGAAAGG - Intergenic
958599342 3:96274896-96274918 GTACAAAGCCTCAGTTAGGCAGG + Intergenic
959365028 3:105446895-105446917 GTACAAAGTCACAGTTAGATAGG + Intronic
959487080 3:106939191-106939213 GTACAAAAATACAATTAGATAGG - Intergenic
959740645 3:109715165-109715187 ATACAAAGTTTCAGTTAGATAGG + Intergenic
959775809 3:110161729-110161751 TTAAAAAACCTCACTTAGATAGG + Intergenic
960016207 3:112891146-112891168 GTACAAAGTTTCAGTTAGACAGG - Intergenic
960474057 3:118102330-118102352 GTACAAAGTCTCAGTTACACAGG - Intergenic
960478664 3:118161543-118161565 GTACAAAGTGTGAATTAGAGAGG + Intergenic
960478665 3:118161572-118161594 GTACAAAGTGTGAATTAGAGAGG + Intergenic
962628099 3:137247617-137247639 GTACAAAGTTACAATTACATAGG - Intergenic
962830913 3:139139455-139139477 ATACAAAATCTCAATTAGATAGG - Intronic
963548240 3:146687869-146687891 GTACAAAGTTTCAATTAATTGGG - Intergenic
963898171 3:150707862-150707884 GTACAAAGTTACAGTTAGATAGG - Intergenic
964091509 3:152882275-152882297 GTGCAAAGCCTCAGTCAGACAGG - Intergenic
965462883 3:168990491-168990513 GTAAACAGGCTCACTTAGATAGG - Intergenic
965632079 3:170743401-170743423 GTACAAAGTTATAATTAGATAGG - Intronic
965908865 3:173746005-173746027 GTACAATGCCTCACTTAGAGAGG - Intronic
966100220 3:176259933-176259955 GTACAAAGCCTCATTTAGAAAGG - Intergenic
966339330 3:178907597-178907619 GTACAAAGTTTCAGTTAGATAGG + Intergenic
966518757 3:180849861-180849883 GTACAAAGTTTCAGTTAGACAGG - Intronic
966649178 3:182280272-182280294 GTACAAAGCCTGACTAAGACAGG - Intergenic
968033648 3:195526494-195526516 GCACATAGCCTCAATTACTTAGG + Intronic
968300782 3:197612570-197612592 GTACAAAGTTTCAGTTAGACAGG + Intergenic
969783976 4:9437465-9437487 GTACAAAGACTCAACTGGACAGG + Intergenic
970069426 4:12140175-12140197 GTACAAAGTTTCACTTAGATGGG + Intergenic
970413006 4:15828436-15828458 GTACAAAATCTCAGTTAGAAAGG - Intronic
971036509 4:22699097-22699119 GTAAAAAACCTCAGTCAGATAGG + Intergenic
971551354 4:27960718-27960740 GTACAAAGTTTCAGTTAGACAGG + Intergenic
972005525 4:34098891-34098913 GTACAAAGTTTCAGTTAGACAGG + Intergenic
972840081 4:42920559-42920581 GTACAAAGCAGCCATTAGAAAGG + Intronic
973078354 4:45959514-45959536 GTACAAAGTTACAATTAGATAGG - Intergenic
973345725 4:49052896-49052918 ATACAAAGTTTCAATTAGACAGG - Intronic
973724525 4:53761967-53761989 TTACAAAGCCTCAGTTAAATAGG + Intronic
973966445 4:56167474-56167496 GTACAAAGTTTCAGTTAGACAGG - Intergenic
974082433 4:57226500-57226522 ATAAAAAGCCTCAATAAGCTAGG - Intergenic
974421880 4:61686750-61686772 GTAAAAAGTTACAATTAGATGGG - Intronic
974497081 4:62645804-62645826 GTACAAAGTTTCAGTTAGACAGG - Intergenic
974714830 4:65654791-65654813 TTATAAATCCTAAATTAGATAGG + Intronic
975126312 4:70786278-70786300 GTACAAAGCTATAGTTAGATAGG + Intronic
975175064 4:71279187-71279209 GTACAAAATTTCAATTAGACAGG - Intronic
975288886 4:72652751-72652773 GTACAAAATTTCAGTTAGATAGG + Intergenic
975583500 4:75928098-75928120 GTACAAAGTTTCAATTAGACAGG - Intronic
976548169 4:86361925-86361947 GTACAAAGTTTCAGTTAGAAAGG + Intronic
976713992 4:88103678-88103700 GTACAAAACCTCAGTTACACAGG - Intronic
977503762 4:97877169-97877191 GTACAAAGTTTCAGTTAGACTGG - Intronic
977959097 4:103064535-103064557 GTACAAAGTGATAATTAGATAGG + Intronic
978258849 4:106726637-106726659 GCACAAAGTTTCAATTAGACAGG + Intergenic
978281040 4:107014530-107014552 GTACAAAGTTACAGTTAGATAGG + Intronic
978741244 4:112140656-112140678 GTACAAAGTTTCAGTTAGACAGG - Intergenic
979080703 4:116336391-116336413 GTACAAAGTTTCAATGAGAGAGG - Intergenic
979127911 4:116999595-116999617 GTACAAAGCCTTAGTTAGACAGG + Intergenic
980015029 4:127639871-127639893 GTACAAAGTTACAGTTAGATAGG - Intronic
980025077 4:127756471-127756493 GTACAAAGTTTCATTTAGACAGG + Intronic
980313713 4:131168117-131168139 ATACAAAGTTTCAATTAGACAGG + Intergenic
981465330 4:145063045-145063067 GTACAAAATTTCAGTTAGATAGG + Intronic
981520731 4:145659915-145659937 GTACAAAGTTACAACTAGATAGG - Exonic
981551288 4:145943972-145943994 GTACAAAGTCATATTTAGATTGG + Intergenic
981622452 4:146717854-146717876 GTACAAAGCCTCAATTAGACAGG - Intronic
981710279 4:147702038-147702060 GTACAAAGCTACAATTAGATTGG + Intergenic
981884482 4:149657114-149657136 GTACAAAGTTACAATGAGATAGG - Intergenic
982111080 4:152055434-152055456 ATACAAAATATCAATTAGATAGG - Intergenic
982785056 4:159527326-159527348 GTACAAAGCTTTAGTTAGACTGG - Intergenic
983023151 4:162704460-162704482 GTACAAAATTTCAATTATATAGG + Intergenic
983370863 4:166856227-166856249 GCACAAAGTTTCCATTAGATAGG + Intronic
983679661 4:170338560-170338582 GTACAAAGTTTCAGTTAGACAGG + Intergenic
984443948 4:179809639-179809661 GTACAAAGTTACAATTAAATAGG + Intergenic
984524869 4:180846696-180846718 GTAAAAAGTTACAATTAGATGGG + Intergenic
985992163 5:3572200-3572222 GTACAAAACCTCAGTTAGGCAGG + Intergenic
986477535 5:8150959-8150981 GGACAAAGCTACCATTAGATAGG + Intergenic
987444235 5:17997799-17997821 GTACAAAGTTTCACTTAGACAGG - Intergenic
987898966 5:23985576-23985598 GTACAAAGTTTCAGTTAGATAGG + Intronic
987932037 5:24414480-24414502 GTACAAAGTTACAATTAGACAGG - Intergenic
988137682 5:27195986-27196008 GTACAAAGTTACAATTAGAAAGG - Intergenic
988378430 5:30470197-30470219 GTACAAATCTCTAATTAGATAGG - Intergenic
989325418 5:40187594-40187616 GTACAAAGTTTCAGTTAGACGGG + Intergenic
989753947 5:44928836-44928858 GTACAAAGTTACAGTTAGATGGG - Intergenic
990004374 5:50928246-50928268 GTACAAAGTTTCAGTTAGACAGG + Intergenic
990752479 5:59031975-59031997 GTACAAAATTTCAGTTAGATTGG + Intronic
990895216 5:60692215-60692237 GTACAAAGCCTCAACTAGACAGG + Intronic
991644222 5:68785365-68785387 GTACAAAATTACAATTAGATTGG + Intergenic
991659681 5:68937617-68937639 GTACAAAGCTTCAGTTAGACAGG + Intergenic
992247411 5:74840140-74840162 GTACAAAGCCTACATTTGACAGG + Exonic
993856278 5:93079838-93079860 GTACAAAGTTTCAGTTAGATTGG - Intergenic
994077059 5:95665311-95665333 GTACAAAATTACAATTAGATAGG - Intronic
994508986 5:100679401-100679423 GTGCAAAGTTACAATTAGATAGG - Intergenic
995165397 5:109034092-109034114 GTACAAAGTCTCAGTTAGATGGG - Intronic
995383030 5:111556346-111556368 GTACAAAGTTTCAGTTAGACTGG - Intergenic
996232707 5:121086449-121086471 GTACAAAAACACAGTTAGATAGG - Intergenic
996632586 5:125652256-125652278 GTACAAAGTTTCAGTTAGGTAGG + Intergenic
997114079 5:131106870-131106892 ATACAAAATTTCAATTAGATAGG + Intergenic
997576060 5:134978194-134978216 GTACAAAGTTACAGTTAGATAGG + Intronic
997605295 5:135171048-135171070 GTACAAAGTTACAATTAGAAAGG - Intronic
998055527 5:139073578-139073600 ATACAAAGTTTCAGTTAGATAGG + Intronic
998242412 5:140459527-140459549 GTACAAAGTTTCACTTAGATAGG + Intronic
998293944 5:140946875-140946897 GTACGAAGTTACAATTAGATAGG + Intronic
998694108 5:144618227-144618249 ATACAAAGCTTCAATTAGACAGG + Intergenic
999577835 5:152999692-152999714 GTACAAAGTCTCATTTAGTAGGG + Intergenic
999616598 5:153431720-153431742 TTACAAAGCCTCTATGAGGTAGG + Intergenic
999659597 5:153846445-153846467 GTACAAAGTTACAATTAGTTAGG - Intergenic
1000267269 5:159649633-159649655 GTACAAAGTTTCCATTAGACAGG - Intergenic
1000765073 5:165277786-165277808 CTACTAAGCATCAACTAGATTGG + Intergenic
1000954887 5:167531594-167531616 GTACAAAGTTTCAGTTAGAGAGG - Intronic
1002678887 5:180944211-180944233 ATACAAAGTTACAATTAGATAGG + Intronic
1002943741 6:1741286-1741308 GTACAAAGTAACAATAAGATAGG - Intronic
1003921926 6:10840458-10840480 GTAAAAAGCATAAGTTAGATAGG + Intronic
1004626921 6:17385580-17385602 GTACAAAGTTTCAGTTAGAGAGG - Intergenic
1004757492 6:18628583-18628605 GCACAAAGTTTCAGTTAGATGGG + Intergenic
1004882271 6:20020768-20020790 GTACAAAGTTTCAATTATACAGG + Intergenic
1005144763 6:22675829-22675851 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1005698491 6:28375146-28375168 GTACAAAGTTACGATTAGATAGG - Intergenic
1006238208 6:32654308-32654330 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1006494543 6:34412681-34412703 GTACAAAGTTTCAGTTAGATAGG - Intronic
1007120321 6:39375238-39375260 GTACAAAGTTTCAATTAGATAGG + Intronic
1007136598 6:39528075-39528097 GTACAAAGCCTCAACTAGATGGG - Intronic
1007357182 6:41329588-41329610 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1008184091 6:48369192-48369214 GTACAAAATTTCAATTAGACAGG - Intergenic
1008245496 6:49166693-49166715 GTACATAGTTACAATTAGATAGG - Intergenic
1008327402 6:50199956-50199978 ATACAAAATTTCAATTAGATAGG + Intergenic
1008460295 6:51761476-51761498 ATACAAAATCTCAGTTAGATAGG + Intronic
1008612151 6:53194679-53194701 GAACAAAGACTAAATTAGAAGGG + Intergenic
1009527171 6:64761931-64761953 GTATAAAGTTTCAATTCGATAGG + Intronic
1010321382 6:74514174-74514196 GTACAAAGTTACAGTTAGATAGG + Intergenic
1010321433 6:74514854-74514876 GTACAAAGTTACAGTTAGATAGG + Intergenic
1010443384 6:75925011-75925033 GTACAAAGTTACAATTAGGTAGG + Intronic
1010564159 6:77388678-77388700 GTACAAAGTTTCAGTTAGACTGG - Intergenic
1010891374 6:81315047-81315069 GTACAAAGTTTCAATTAGATGGG + Intergenic
1011026891 6:82879242-82879264 GGACAAAGCCTCAGTTAGATGGG - Intergenic
1011085962 6:83541379-83541401 GTACAAAGTTTCAATTACAGGGG + Intergenic
1011153663 6:84303996-84304018 GTACAAAGTGTCAGTTAGCTAGG + Intergenic
1011990580 6:93510620-93510642 GTACAAAGTTTTAGTTAGATAGG - Intergenic
1012148487 6:95716742-95716764 GTACAAAGCCCCAGTTAGACAGG - Intergenic
1012645553 6:101675123-101675145 GTACAAAGTTACAATTAGAAAGG - Intronic
1012688962 6:102290397-102290419 GTACAAAGCTACAATTAGATAGG - Intergenic
1012841903 6:104339461-104339483 GTTCACAGCCCCATTTAGATAGG + Intergenic
1013786445 6:113786935-113786957 GTAGAAAGCATCAGTTAGAATGG - Intergenic
1013821421 6:114157461-114157483 GTACAAAGTTTCAGTTAGATAGG + Intronic
1013943911 6:115699325-115699347 GTACAAAGTTTCAGTTAGACAGG - Intergenic
1014207859 6:118676281-118676303 GTACATAGTTTCAGTTAGATAGG - Intronic
1014323291 6:119958961-119958983 GTACAAAGCCTAAATTAGGAGGG + Intergenic
1014375219 6:120663988-120664010 GTACAAAGTTTCAGTTAGGTAGG - Intergenic
1014574733 6:123056320-123056342 GTACAAAGTTTCAATTAGACAGG - Intronic
1014794568 6:125709841-125709863 GTACAAAGTTTCAGTTAGAGTGG + Intergenic
1015211997 6:130708964-130708986 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1018032237 6:159850465-159850487 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1020147286 7:5654380-5654402 GTAAAAAGCCTCAATCAGGGTGG + Intronic
1020516737 7:9131087-9131109 GTACAAAATTTCAGTTAGATGGG - Intergenic
1021589381 7:22243882-22243904 GTACAAAATTTCAGTTAGATAGG - Intronic
1022651387 7:32279353-32279375 GTACAAAGTTGCACTTAGATAGG + Intronic
1022751865 7:33236880-33236902 GTACAAAGTTTCAATTAGACTGG - Intronic
1023347059 7:39281403-39281425 GTACAAAGTTACAGTTAGATAGG - Intronic
1025794993 7:64731296-64731318 GTACAAAGTTTCAAATAGAAGGG - Intergenic
1027551804 7:79607331-79607353 TTACAAAGTTTCCATTAGATAGG + Intergenic
1027913899 7:84289253-84289275 GTACAAAACTACAGTTAGATAGG + Intronic
1028074000 7:86488209-86488231 ATACAAAATTTCAATTAGATAGG - Intergenic
1028288353 7:89033063-89033085 ATACAAAGCCTCAATTAGACAGG - Intronic
1028396986 7:90380750-90380772 GAACAAAGATTCAATTAAATAGG - Intronic
1028412312 7:90543172-90543194 GTACAAAGTTTCAGTTAGAGAGG + Intronic
1029964890 7:104729474-104729496 GTACAAAGTTACAGTTAGATAGG - Intronic
1030739941 7:113096823-113096845 GTACAAAGTTTCAGTTAGACTGG + Intergenic
1030917202 7:115329870-115329892 ATACAAATATTCAATTAGATAGG + Intergenic
1031211929 7:118840306-118840328 TTACAAAACTTCATTTAGATAGG - Intergenic
1031229634 7:119089021-119089043 GTACAAAGTTTCAGTTAGAGAGG - Intergenic
1031245585 7:119307253-119307275 GAAAAAAGCCTCAATTAACTAGG + Intergenic
1031278925 7:119770095-119770117 GTACAAAGCCTTAATTAGACAGG + Intergenic
1031651003 7:124290048-124290070 GTACAAAGTTTTAATTAGATGGG - Intergenic
1032919032 7:136525435-136525457 GTACAAAGTTTCAGATAGATAGG + Intergenic
1033702169 7:143850485-143850507 GTACAAAGGTTCAGTTAGATAGG + Intergenic
1034130719 7:148714445-148714467 GTGCGAAGTCTCAGTTAGATAGG - Intronic
1035594602 8:846240-846262 GCACAAAGCTACAGTTAGATAGG - Intergenic
1035804435 8:2441145-2441167 GCACAAAGCTTCAGTGAGATCGG + Intergenic
1036120124 8:6007404-6007426 GTAAAAAGGCTCAATTTGACTGG + Intergenic
1036834912 8:12054522-12054544 GAACAAAGCCTGAATGAAATAGG - Intergenic
1036856755 8:12301086-12301108 GAACAAAGCCTGAATGAAATAGG - Intergenic
1037127371 8:15367292-15367314 GTACAAAGCTTCTGTTAGATGGG + Intergenic
1038107835 8:24456083-24456105 GTACAAAGCCCAAGTTACATGGG - Intronic
1039159868 8:34605595-34605617 ATACAAAGCCTCAATTAGATGGG - Intergenic
1039331805 8:36545440-36545462 GTACAAAGCCTTGGTTAGATAGG + Intergenic
1039646599 8:39290949-39290971 GAACAAAGTCTGAATTAGAAGGG - Intergenic
1039657432 8:39424693-39424715 GTACAATGTTACAATTAGATAGG + Intergenic
1040793479 8:51262552-51262574 GTACAAAGTTTCAGTTAGACTGG + Intergenic
1041154482 8:54971069-54971091 GTACAAAGTTTCAGTCAGATAGG + Intergenic
1042065864 8:64875183-64875205 GTACAAAGTTTTAATTAGACAGG - Intergenic
1042109318 8:65363093-65363115 ATATGAAGTCTCAATTAGATAGG + Intergenic
1042756598 8:72220876-72220898 GTTCAAAGCCTACTTTAGATTGG + Intergenic
1042949932 8:74190571-74190593 GTACAAAGTTACAGTTAGATAGG - Intergenic
1043630474 8:82325004-82325026 GTATAAAGCCTCAGTTATATAGG + Intergenic
1043736866 8:83759008-83759030 GTACAAAGTTACAATTAAATAGG + Intergenic
1044195245 8:89368236-89368258 GTACAAAGCCTCAGTTAGGCAGG + Intergenic
1044338200 8:91014624-91014646 GTACAAAGTCTCAGTTAGGCAGG + Intronic
1044831498 8:96254378-96254400 GTACAAAGTTTCAATTAGACAGG - Intronic
1045132160 8:99165284-99165306 ATACAAAATTTCAATTAGATAGG - Intronic
1045134082 8:99194360-99194382 GTACAAAGTTTCAGTTAGACAGG - Intronic
1046469760 8:114655534-114655556 ATACAAAATTTCAATTAGATAGG + Intergenic
1048061791 8:130926693-130926715 ATACAAAATTTCAATTAGATAGG - Intronic
1049066256 8:140318485-140318507 GTAGAAAGCCTCAGTTAGACAGG - Intronic
1050355989 9:4782834-4782856 GTACAGAGACTCCATTAGTTTGG + Intergenic
1050956037 9:11661343-11661365 GTATAATGCTGCAATTAGATGGG + Intergenic
1051201079 9:14624686-14624708 GTACAAAGTTACAATTAGAAAGG + Intronic
1051720899 9:20036444-20036466 GTACAGAGCTTCAATTAGACGGG - Intergenic
1052420057 9:28232718-28232740 GTACAAAGTTTCAATTAAACAGG - Intronic
1052732068 9:32298931-32298953 GTACAAGGTCTCAGTTAGACAGG + Intergenic
1053192148 9:36081322-36081344 GAACTAAGCCTCAGTTAGAAAGG - Intronic
1054718737 9:68582792-68582814 GTACAAAGTTTCAGTTAGACTGG + Intergenic
1056937308 9:90925938-90925960 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1058241910 9:102573309-102573331 GTACAAAGTTACAGTTAGATAGG + Intergenic
1058313075 9:103530417-103530439 GTACAAACCTTCAGTTAGATAGG + Intergenic
1058382826 9:104396655-104396677 GTACAAAGTTTCAGTTAGATAGG + Intergenic
1059509541 9:114831312-114831334 GTACAAAGTTACAATTAGATAGG - Intergenic
1059979060 9:119749322-119749344 ATACAAAATTTCAATTAGATAGG - Intergenic
1060329575 9:122654618-122654640 GTACAAAGTTTCAGTTAGACAGG - Intergenic
1185828699 X:3277461-3277483 GTACAAAGTTTCAGTTAGACAGG + Intronic
1186134076 X:6500495-6500517 GTAGCAAACCTCATTTAGATAGG - Intergenic
1186549985 X:10493531-10493553 GTGCAAAACCTCAATTAGAGAGG + Intronic
1186934761 X:14436284-14436306 GTACAAAGTTACAATTAGATAGG - Intergenic
1187136116 X:16549156-16549178 GTATAAAGTTACAATTAGATAGG - Intergenic
1187780028 X:22810435-22810457 ATACAAAATTTCAATTAGATGGG + Intergenic
1188121468 X:26313809-26313831 GTACAAAGCTACAATTAAATAGG - Intergenic
1188146552 X:26620881-26620903 GTACAAAGTAACAATCAGATGGG + Intergenic
1188248555 X:27863384-27863406 GTACAAAATTTCAGTTAGATGGG + Intergenic
1188388174 X:29587416-29587438 GCACAAAATTTCAATTAGATAGG + Intronic
1188492537 X:30752978-30753000 GTAAAAAGCCTCAATCAGGTAGG - Intergenic
1188602594 X:31987397-31987419 GTACAAAGTCACGATTAGAAAGG - Intronic
1188899834 X:35717071-35717093 ATACAAAGTTTCAGTTAGATAGG - Intergenic
1188995297 X:36877541-36877563 ATACAAAGTTTCAGTTAGATGGG + Intergenic
1189147386 X:38668992-38669014 GTACAAAGTCACAGCTAGATAGG + Intronic
1189224938 X:39404823-39404845 GTACAAAGTTTCAGTTAGACAGG - Intergenic
1189407417 X:40737249-40737271 GTACAAAGTTTCAGTTAGATAGG - Intergenic
1189585215 X:42453578-42453600 ATACAAAGCCTCAATTAGGCAGG + Intergenic
1189773952 X:44453392-44453414 GTGAAAAGCCTCCATTAAATGGG + Intergenic
1189844562 X:45121907-45121929 GTACAAAGTTTCAGTTAGGTAGG + Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1189876596 X:45442561-45442583 GTACAAAGCTACAATTATATAGG - Intergenic
1190258651 X:48784174-48784196 GTACAAAGCTACAGTTAGATAGG + Intergenic
1190582306 X:51901184-51901206 GTACAAAGTTTCATTTAGATAGG - Intronic
1190949701 X:55131207-55131229 GTACAAAGCCTCAATTAGACAGG + Intronic
1191596229 X:62947036-62947058 GAACAAAGCCTCCATGAAATTGG + Intergenic
1191708849 X:64125584-64125606 GTACATAGCTTCAGTTAGATAGG + Intergenic
1192462832 X:71332109-71332131 GTACAAAGCCTCAATTAGGAGGG + Intergenic
1193143251 X:78051720-78051742 GTACAAAGATACAATTAGATAGG - Intergenic
1193304824 X:79936177-79936199 ATACAAAGCTACAGTTAGATAGG - Intergenic
1193344961 X:80394970-80394992 GTCCAAAGTTACAATTAGATAGG - Intronic
1193365478 X:80627129-80627151 GTACAAAGTTGCAATTAGAAAGG - Intergenic
1193623128 X:83781785-83781807 GTACAAAGTTACAATTAGAAAGG + Intergenic
1193792569 X:85833383-85833405 GTACAAAGTTTCAGTTAGATAGG + Intergenic
1193847049 X:86485412-86485434 GTACAAACCTACAGTTAGATAGG + Intronic
1193882331 X:86938163-86938185 GTACAGAGTTTCCATTAGATAGG - Intergenic
1193934752 X:87603835-87603857 GTACAATGTGACAATTAGATTGG - Intronic
1195407347 X:104529938-104529960 GTATAAAGTTACAATTAGATAGG + Intergenic
1195407940 X:104537560-104537582 GTACAAAGTTTTAATTAGACAGG - Intergenic
1195457609 X:105086506-105086528 GTATAAAGTTTCAGTTAGATAGG + Intronic
1195612209 X:106880576-106880598 GTACAAAGTTACAGTTAGATAGG + Intronic
1195680730 X:107544272-107544294 ATACAAAGGCTCAGTTAGACAGG + Intronic
1195712233 X:107782572-107782594 GTTCAAAGCTTCAGTTACATGGG - Intronic
1195811742 X:108841104-108841126 ATACAAAGTTTCAGTTAGATAGG - Intergenic
1195980368 X:110570790-110570812 GTACAAAGCCCCAATTAGACAGG + Intergenic
1196029522 X:111081110-111081132 GTATAAAGTTTCAGTTAGATAGG + Intronic
1196571970 X:117276334-117276356 GTAGAGAGTTTCAATTAGATGGG + Intergenic
1197308278 X:124871102-124871124 GTACAAAGTTACAATTAAATAGG - Intronic
1197670031 X:129266639-129266661 ATACAAAGTTTCAGTTAGATAGG - Intergenic
1197683921 X:129417709-129417731 GTAGAAAGCCTCCATTAGAAAGG + Intergenic
1197863045 X:130990499-130990521 GTACAAAGTTTCAATTAGACAGG + Intergenic
1198143371 X:133828717-133828739 GTATAAAGATTCAGTTAGATAGG + Intronic
1198609290 X:138379752-138379774 GTACAAAGTTTCAGTTACATAGG + Intergenic
1198698313 X:139367804-139367826 GTACTAAGTTTCAGTTAGATAGG - Intergenic
1198885503 X:141331516-141331538 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1199019536 X:142861161-142861183 GTACAAAGTTTCAGCTAGATAGG - Intergenic
1199055001 X:143283319-143283341 GTACAAAGCTTAAGTTAGACAGG + Intergenic
1199127536 X:144140316-144140338 GTACACAGCCTTTATTAAATAGG + Intergenic
1199132840 X:144213512-144213534 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1199926355 X:152469340-152469362 ATACAAAGCTTCAGTTAGAAAGG + Intergenic
1200094281 X:153649971-153649993 GGACAAGGCCTCATCTAGATGGG - Exonic
1200177782 X:154129387-154129409 GTACAAAATAACAATTAGATGGG + Intergenic
1201250393 Y:12052095-12052117 GTACAAAGTTTCAATTAGACAGG - Intergenic
1201722888 Y:17121044-17121066 GTACAAAGATGCACTTAGATAGG - Intergenic
1201922618 Y:19250633-19250655 GAACAAAGCCTGAATTTAATGGG + Intergenic