ID: 916717574

View in Genome Browser
Species Human (GRCh38)
Location 1:167458146-167458168
Sequence CTGAGCAGGGCACAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 531
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 487}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916717574_916717581 5 Left 916717574 1:167458146-167458168 CCTTCCACCTGTGCCCTGCTCAG 0: 1
1: 0
2: 1
3: 42
4: 487
Right 916717581 1:167458174-167458196 CAGTGTTCAAGCTGGTCATCAGG 0: 1
1: 0
2: 1
3: 7
4: 130
916717574_916717579 -3 Left 916717574 1:167458146-167458168 CCTTCCACCTGTGCCCTGCTCAG 0: 1
1: 0
2: 1
3: 42
4: 487
Right 916717579 1:167458166-167458188 CAGCGATCCAGTGTTCAAGCTGG 0: 1
1: 1
2: 0
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916717574 Original CRISPR CTGAGCAGGGCACAGGTGGA AGG (reversed) Intronic
900305896 1:2007763-2007785 CTTTGCAGGGCCAAGGTGGATGG + Intergenic
900513961 1:3072675-3072697 CTGGGGAGGGGACTGGTGGACGG - Intronic
900754272 1:4423003-4423025 CTGAGCAGGGCACGGCGGGGTGG - Intergenic
901456902 1:9368275-9368297 CCAGGGAGGGCACAGGTGGAAGG - Exonic
902219484 1:14955825-14955847 CTGAGCACTGCACAGGAGGGAGG - Intronic
902282162 1:15382625-15382647 CTGAGGAGTATACAGGTGGATGG + Intronic
902325852 1:15700198-15700220 CTGAGCAGGGCAGAGCAGCAGGG - Intronic
902513949 1:16980102-16980124 CAGAGCCGGGCTCAGGGGGAGGG + Intronic
903605224 1:24570670-24570692 CTGAGCAGGGGCCTGGGGGAGGG - Intronic
904239382 1:29134274-29134296 CAGGGCAGGCCCCAGGTGGAGGG + Intergenic
905177968 1:36149757-36149779 CTGAGCCGGGCGCGGGGGGAGGG - Intronic
905290011 1:36914880-36914902 CTGGGCAGGGCACAACAGGAGGG + Intronic
905790245 1:40785615-40785637 CTGCACAGGCCACAGATGGATGG - Intronic
907248695 1:53123642-53123664 CAGAGGAGGGCACAGCTGGATGG + Intronic
907255246 1:53173943-53173965 CTGAGCTGGAGACAGGTGGGAGG + Intergenic
907431500 1:54414705-54414727 CTGTGAAGGGCACAGTTGGCCGG + Intergenic
907463779 1:54621905-54621927 CCAAGAAGGGCACAGGAGGAAGG + Intronic
908432733 1:64074509-64074531 CTGTGCAAGGCACAGAGGGAGGG + Intronic
909922050 1:81394360-81394382 CTGGGAAGGGTACAGGAGGAGGG - Intronic
911842150 1:102696658-102696680 CTGAGTGGGGCAGAGGTGTATGG - Intergenic
912246115 1:107963962-107963984 CTGAGCAGGGCACTGCAGGAAGG + Intronic
912410639 1:109478575-109478597 CAGAGCAGGGCTGAGGTGGCTGG - Intronic
912444166 1:109721790-109721812 ATGAGAAGGGCAGAGGTGGAGGG - Intronic
912462757 1:109847582-109847604 CTGAGCATGTCACTGGTGCATGG - Intergenic
912475382 1:109931344-109931366 CTGACCAGGGCAGAGGTTGCTGG + Intergenic
912623117 1:111185731-111185753 CAGAGCAGGACAAAGGAGGAAGG + Intergenic
913112169 1:115666463-115666485 CTGGTCAGGGCAGAGCTGGATGG + Intronic
913353484 1:117890161-117890183 CTGAGAAGGGGACTGGTGGTGGG + Intronic
913565245 1:120067384-120067406 CTCAGCAGAGCAGAGGTGGAGGG + Intronic
913632884 1:120726175-120726197 CTCAGCAGAGCAGAGGTGGAGGG - Intergenic
914285834 1:146226742-146226764 CTCAGCAGAGCAGAGGTGGAGGG + Intronic
914546866 1:148677495-148677517 CTCAGCAGAGCAGAGGTGGAGGG + Intronic
914619698 1:149393177-149393199 CTCAGCAGAGCAGAGGTGGAGGG - Intergenic
914952284 1:152126845-152126867 TAGAGAAGGGCACAGGTGGTGGG + Intergenic
915350072 1:155218718-155218740 TTGAGCAAGGCACAGATGGAGGG - Intergenic
915353470 1:155240956-155240978 TTGAGCAAGGCACAGATGGAGGG - Intronic
916468263 1:165093703-165093725 CTGTGCAGGGAACTGCTGGAAGG + Intergenic
916641202 1:166730197-166730219 CAGAGCAGGGGTCAGGGGGAGGG - Intergenic
916717574 1:167458146-167458168 CTGAGCAGGGCACAGGTGGAAGG - Intronic
918034647 1:180855898-180855920 GAGAGCAGTGCACAGGAGGAAGG - Intronic
918109403 1:181442362-181442384 GTGTGAAGGGCACAGGTGTAAGG + Intronic
918256745 1:182755354-182755376 ATGAGAAGGGCACAGGAGAATGG + Intergenic
918359505 1:183741367-183741389 CTGAGCAAGCCAGTGGTGGATGG + Intronic
920182663 1:204142054-204142076 CTGACCATGTCACAGGTAGAAGG + Intronic
920400889 1:205675766-205675788 CTGGGCAGGGCTCAGGTGGAGGG - Intronic
920526448 1:206670424-206670446 CTGAGGAGGGCACAGGTGACTGG + Intronic
920791448 1:209096815-209096837 CTGAGCAGTACTCAGATGGACGG - Intergenic
920835843 1:209510006-209510028 CTGAGCAGGTCACAGGTCACAGG - Intergenic
920988208 1:210910531-210910553 ATGAACAGGGCACTGGTGCAGGG - Intronic
921192562 1:212723769-212723791 CTGAGCTGGGCTTAGCTGGATGG - Intergenic
923610669 1:235490032-235490054 CTGAGCAGGCCACAGAAGGAAGG - Intronic
923764572 1:236881048-236881070 CTGAGCAGCAGACAGGTAGATGG + Intronic
923882870 1:238122813-238122835 CTGAGTAAAGCACATGTGGATGG - Intergenic
924514008 1:244751322-244751344 GTGAGCAGGGCAAAAATGGAGGG - Intergenic
1063116345 10:3074527-3074549 AGGAGCAGGCCACAGATGGAAGG + Intronic
1063301112 10:4849604-4849626 CTGGGGAGGGCAGGGGTGGATGG + Intergenic
1063740032 10:8807445-8807467 CTGAGCAGCCTTCAGGTGGATGG + Intergenic
1064005798 10:11697988-11698010 CTTAGGAGGGAAAAGGTGGAAGG - Intergenic
1064280684 10:13948591-13948613 CTGAGCAGAGAGCAGGTGGTGGG + Intronic
1064742910 10:18451376-18451398 CAGAGCAGGGGCCAGGTGGGAGG - Intronic
1065112818 10:22456700-22456722 CAGAGCAGTGCAGACGTGGAGGG - Intergenic
1067159378 10:43810422-43810444 CTGAGTCAGTCACAGGTGGAAGG + Intergenic
1067554578 10:47259640-47259662 CTGGGCAGGGCTCAGGGGGACGG + Intergenic
1067709382 10:48636188-48636210 CTGTGCAGGGCAGAGGAAGAAGG - Intronic
1067715243 10:48685444-48685466 CTGAGGAGTGCAGAGTTGGAGGG + Intronic
1069562717 10:69442034-69442056 GAGAGCAGGGGACAGGAGGAAGG + Intergenic
1069819898 10:71220957-71220979 CGGAGTGGGGCAGAGGTGGAAGG + Intronic
1069825096 10:71250079-71250101 TTGAGCAGGGCAGAGGTGCTGGG + Intronic
1069909161 10:71749413-71749435 CTTTGCAGGGCTGAGGTGGAAGG - Exonic
1069964811 10:72105630-72105652 GTGAGCAGGGGACAGCAGGATGG - Intronic
1070395522 10:76008564-76008586 CTGTGCAGGGCACAGGGGACTGG + Intronic
1070592587 10:77811414-77811436 CTGAGCTGAGGACAGGTGGAGGG - Intronic
1070985772 10:80688561-80688583 CTCAGCAGGGCTGAGGTGGGAGG - Intergenic
1071361668 10:84852200-84852222 CTGAGCAGGGCACATTAAGAAGG - Intergenic
1071427865 10:85577359-85577381 CTGGGCAGAAGACAGGTGGATGG + Intergenic
1071463017 10:85916362-85916384 CAGAGCAGGCCCCAGGGGGATGG - Intronic
1074771715 10:116739217-116739239 CCTAGCAGCGCACAGCTGGAAGG - Intronic
1075347256 10:121692309-121692331 CTGAGCTTGCCACATGTGGACGG + Intergenic
1075642884 10:124077586-124077608 CAGAGCAGGGCACTGGTTGGAGG - Intronic
1076093771 10:127713666-127713688 CTGACCAGGGAGCAGGTGGGCGG - Intergenic
1076220646 10:128730651-128730673 CTGATAATGACACAGGTGGAAGG - Intergenic
1076336589 10:129710542-129710564 CTGGGCAGGGGCCAGGTGTATGG + Intronic
1076364738 10:129914607-129914629 CTGCCCAGGGCTCAGGTGAAGGG - Intronic
1076478607 10:130769407-130769429 CTGGGCAGGGTGCAGGTGGCTGG - Intergenic
1076521806 10:131085864-131085886 CTGGGCTGGGCACTGCTGGAAGG - Intergenic
1076597856 10:131637015-131637037 CTGACCACGGCACTGTTGGAGGG + Intergenic
1076849753 10:133087065-133087087 CCAAGGAGGGAACAGGTGGAGGG + Intronic
1077179894 11:1207549-1207571 CTGAGCTGCGCACAGGCGCACGG - Intergenic
1077328054 11:1972124-1972146 CTGGGCAGGGCACCGGACGAGGG + Intronic
1077393778 11:2311416-2311438 CTCGTCAGGGCACAGGGGGAGGG - Intronic
1077540177 11:3142980-3143002 CAGAGCAGGGCAGAGGAGGCAGG + Intronic
1078080881 11:8204056-8204078 CCGAGGAGGGCACAGATGAAAGG + Intergenic
1078531365 11:12139213-12139235 AGGAGCAGGGCAGAGGAGGAGGG - Intronic
1078559836 11:12361840-12361862 CTCAGCAGGGCAGAGGTGGCAGG + Intergenic
1078564091 11:12398571-12398593 CTGGGCTAGGCACAGGAGGACGG - Intronic
1080824281 11:35834865-35834887 GTGAGCAGGGGGAAGGTGGAGGG - Intergenic
1081853569 11:46290358-46290380 CTGGGCTGGGCTCAGGAGGAGGG - Intronic
1083262359 11:61530206-61530228 AAGAGCAAGGCGCAGGTGGAAGG - Intronic
1083360748 11:62105900-62105922 CAGAGAAGGGCACAGAGGGAGGG - Intergenic
1084031330 11:66482369-66482391 CTGAGCAGAGCATAGATGTAGGG - Exonic
1084047729 11:66579745-66579767 CTCTGCAGGCCACAGCTGGAGGG + Intergenic
1084157618 11:67322968-67322990 ATGAACAGGGCTGAGGTGGAGGG - Intronic
1084319333 11:68364768-68364790 CAGAGCAGGACACAGGAGGGTGG + Intronic
1085017543 11:73185346-73185368 CAGGGCTGGGCAGAGGTGGATGG - Intergenic
1085120690 11:73965566-73965588 CTCTGCTGGGCAAAGGTGGAGGG - Intronic
1085139278 11:74125856-74125878 CTAAGGAGTGCAGAGGTGGAGGG - Intronic
1085449226 11:76622054-76622076 CTGGGCAGGGGGCAGGGGGAGGG + Intergenic
1086183222 11:83980936-83980958 CAGAGCAGGGATCAGGTGAAGGG + Intronic
1088757589 11:112898807-112898829 CTGAGCATGGATCAGCTGGATGG - Intergenic
1088856653 11:113761385-113761407 CTCAGCAGGGCTAAGGTGGGAGG - Intronic
1089138887 11:116270791-116270813 CTGGGCAGGGCCCGGGTGGATGG + Intergenic
1089194606 11:116686893-116686915 CTGAGAAGAAAACAGGTGGACGG + Intergenic
1089461656 11:118657597-118657619 CTAAGCAAGGCACCAGTGGAAGG - Exonic
1089598415 11:119597769-119597791 GTGAGCAGAGTACAGGGGGAGGG - Intergenic
1089614153 11:119685769-119685791 GTGAGCAGAGCAAAGGTGGCAGG - Intronic
1089773609 11:120820649-120820671 CTGCGCAGGACACAGGTGCCTGG - Intronic
1090083944 11:123634272-123634294 AGGAGCAGGGCACAGGAGCAAGG + Intronic
1090331193 11:125933425-125933447 GTGAGCAGGGCATGGCTGGAGGG - Intergenic
1090542362 11:127722350-127722372 CTAAGCAGGCCCCACGTGGAGGG + Intergenic
1090893681 11:130950364-130950386 GTGGGCAGGGCTCAGTTGGAAGG - Intergenic
1091346091 11:134855219-134855241 TTGAGCAAAGCACAGGTGGCTGG - Intergenic
1091366818 11:135029107-135029129 CTGGGCAGGGCAGTGGAGGAAGG - Intergenic
1202811033 11_KI270721v1_random:27304-27326 CTGGGCAGGGCACCGGACGAGGG + Intergenic
1091780829 12:3213644-3213666 CTGAGAAAGGGACAGGTGAAGGG - Intronic
1092001824 12:5039031-5039053 CTGTGCTGGGGACAGGTGGCTGG - Intergenic
1092033019 12:5305621-5305643 CTGGCCAGGGCACAGATGGTGGG - Intergenic
1092406072 12:8222926-8222948 CTGATCAGCACTCAGGTGGAGGG - Intronic
1094144502 12:27214397-27214419 CAGAGCAGGGCAGAGGAGGTAGG + Intergenic
1094372120 12:29750159-29750181 GGGGGCAGGGCACAGGTGAAGGG - Intronic
1094487491 12:30936643-30936665 GTGAGCACTGCATAGGTGGATGG + Intronic
1095098196 12:38159017-38159039 CTGAGTGGGACCCAGGTGGACGG + Intergenic
1095417081 12:41988889-41988911 CTTGGCTGGGCTCAGGTGGATGG + Intergenic
1096077618 12:48815043-48815065 CCGAGCCGGGGACGGGTGGATGG + Intronic
1096473597 12:51894983-51895005 CTGAGCAGGTTGGAGGTGGAGGG - Intergenic
1098014546 12:66090555-66090577 CTCAGCAGGTCAGAGCTGGAAGG + Intergenic
1098155545 12:67594070-67594092 CTGAGCAGGGTTCAGCTGGGTGG - Intergenic
1099317083 12:81097581-81097603 AGGAGCAGGACACAAGTGGAGGG - Intronic
1099323155 12:81177208-81177230 CTGAACAGGGAAAAGCTGGATGG + Intronic
1101848834 12:108386215-108386237 ATGAGCAGGGCAGAGGTGACTGG + Intergenic
1102469312 12:113150592-113150614 CTGAGCAGGGCAGCAGTGGCAGG - Intronic
1102743077 12:115225084-115225106 CTGAGCTGGCCACAGAAGGAAGG + Intergenic
1103361842 12:120359163-120359185 CTGTGCAGGGAGCAGGTTGAAGG - Intronic
1103534645 12:121626425-121626447 GTGGGCGGGGCACAGGTGGGCGG + Intergenic
1103741769 12:123096061-123096083 CTGAGCAGGCGACATGTGTATGG - Intronic
1103825838 12:123737245-123737267 CTGCGCCGGGCACTGGAGGAGGG + Exonic
1104064522 12:125296225-125296247 CAGAGCAGGGCATAGGCAGAAGG - Intronic
1104121645 12:125805544-125805566 CTGAGCAACTCACAGGTGGAGGG + Intergenic
1104262175 12:127194354-127194376 CTGAGCTGGAGACAGGGGGAAGG - Intergenic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1105922977 13:24982620-24982642 CTGGGCAGGAGACAGGTGCATGG - Intergenic
1106123586 13:26882095-26882117 CTGATCAGGGAACCGGAGGATGG + Intergenic
1106140321 13:27006203-27006225 CTCAGAAGGACGCAGGTGGAAGG - Intergenic
1106382648 13:29255214-29255236 CTGAGCAGAGCAGAGACGGAAGG + Intronic
1106548332 13:30749877-30749899 CTCTGCAGGGCACAGATGAAGGG + Intronic
1108266092 13:48710303-48710325 CTGGGCAGGGCAAAGTGGGATGG + Exonic
1110298273 13:73895630-73895652 CTACACAGGGCACAGGAGGAAGG + Intronic
1110976399 13:81841300-81841322 CTGAGCAGTTCACAGCTTGAAGG - Intergenic
1113558364 13:111256620-111256642 GTGAGCAGGGAAGAGGAGGAAGG - Intronic
1113637369 13:111929014-111929036 CTGAGCTGGGCACAGTTTCAAGG - Intergenic
1115806157 14:37054344-37054366 TTGGGCAGGGCTCAGCTGGATGG - Intronic
1115853418 14:37604805-37604827 ATGAGAAGGGCAGAGGAGGAAGG - Intronic
1117516710 14:56509023-56509045 CTGAGCAGGACAAAGTAGGATGG + Intronic
1118324347 14:64771226-64771248 CTGCCCAGGGCACTGCTGGAAGG + Intronic
1118405666 14:65421347-65421369 CTCAGCATGGTAGAGGTGGAAGG + Intronic
1118733913 14:68688963-68688985 CTGAGCATGGCTGAGGAGGAGGG + Intronic
1120508563 14:85383687-85383709 CTGAGCTGGGATCAGCTGGATGG - Intergenic
1121428680 14:93872050-93872072 CTGTGGAGGGCACAGGAGGTGGG + Intergenic
1121527201 14:94627455-94627477 CTGGAAAGGGAACAGGTGGAGGG + Intergenic
1122148260 14:99706991-99707013 TTGAGCAAGGGACAGGTGCAGGG + Intronic
1122156422 14:99753093-99753115 GTGGGCAGGACACATGTGGAGGG + Intronic
1122218176 14:100218139-100218161 CTGAGAAGGGCAGAAGTGGGGGG - Intergenic
1122265246 14:100543700-100543722 TGGTGCAGGGTACAGGTGGATGG - Intronic
1122308424 14:100779846-100779868 CGGAGCAGGCCTCGGGTGGATGG - Intergenic
1122802366 14:104238078-104238100 CCGAGGTGGGCACAGGAGGAAGG + Intergenic
1123162626 14:106293943-106293965 CTGAGGAAGGCACAGGTGTGGGG + Intergenic
1202946621 14_KI270726v1_random:33505-33527 CTGAGGACGGGACAGGTGGGCGG + Intergenic
1124516027 15:30368020-30368042 CTCACCTGGGCCCAGGTGGAAGG - Intronic
1124726893 15:32162711-32162733 CTCACCTGGGCCCAGGTGGAAGG + Intronic
1125202253 15:37110499-37110521 CTGGGCAGGGCCAAGGTGGGAGG - Intergenic
1125254195 15:37744687-37744709 CTGAGCAGTGCGGAGGAGGATGG - Intergenic
1125583451 15:40803845-40803867 CTGAGCTGGGCAGTGGTGGCTGG - Intronic
1126308505 15:47288798-47288820 CTGTGGAGTGTACAGGTGGAAGG - Intronic
1126928740 15:53622622-53622644 CTGAGGAGGGAGCAGGGGGAGGG + Intronic
1127372769 15:58356235-58356257 CTGAACTGGGCACAAATGGATGG + Intronic
1127395578 15:58541762-58541784 CTGAGGAGGGGACAGAGGGAGGG - Intronic
1127877398 15:63122508-63122530 GTGGGCGGGGCCCAGGTGGAGGG + Intronic
1129672156 15:77613398-77613420 TTTTGCAGGGCGCAGGTGGAGGG - Exonic
1130062233 15:80578306-80578328 CTGACCAGGGCAGGGGTGCAAGG + Intronic
1131275593 15:90978102-90978124 GTGTGTAGGGCACAGATGGAAGG - Intronic
1131439206 15:92446111-92446133 CTGAGAAGGGCTCACCTGGATGG + Intronic
1132514581 16:360193-360215 CGGCGGAGGGCACAGGTGGGCGG - Intergenic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1133022188 16:2971628-2971650 CGGAGCCGAGCACTGGTGGAGGG - Exonic
1133943259 16:10327995-10328017 CTTAGCAGAGGACAGGTGGGAGG - Intronic
1135524732 16:23205754-23205776 CTGGGGATGGAACAGGTGGATGG - Intronic
1136395746 16:29991594-29991616 CTGGGCAGGGCAGGGGTGGGTGG + Intronic
1138351912 16:56350582-56350604 CTAAGCAAGGCAGATGTGGAGGG - Intronic
1138578878 16:57926642-57926664 CTGTGCTGGGCACAGGAGGATGG - Intronic
1139465879 16:67153879-67153901 CTGGGCAGGGGACAGGGGGTAGG - Intergenic
1139481677 16:67234186-67234208 CGGAGCAGGACACAGGGGGCAGG + Exonic
1140315338 16:73891026-73891048 CTGAGCGGGGGTGAGGTGGAGGG - Intergenic
1141153640 16:81581984-81582006 CTGGGGAGGCCTCAGGTGGAAGG + Intronic
1142256973 16:89018754-89018776 CTGGGCTGGGCTCAGGAGGATGG - Intergenic
1142660349 17:1424768-1424790 GTGAGCCTGACACAGGTGGATGG + Intronic
1142734071 17:1883506-1883528 CTTAGCAGGGCAAAGGTGGGAGG + Intronic
1142954297 17:3510773-3510795 CTGGGCAGGGCCCAGGTAGATGG - Intronic
1143100853 17:4503928-4503950 CTGAGCTGGGTGCAGGAGGAGGG + Intronic
1143159524 17:4860041-4860063 CGGAGCGGGGTACAGGGGGAAGG + Intronic
1143326030 17:6099011-6099033 CTGAGCAGGAACCAGGTGGCAGG + Intronic
1143526946 17:7478710-7478732 CTGAGCAGGGCACAGCATGCTGG - Intronic
1144073467 17:11695280-11695302 TTGAGGATGGCAAAGGTGGAAGG + Intronic
1144253655 17:13444184-13444206 CTGATCAGAGCACTAGTGGATGG - Intergenic
1144728679 17:17514577-17514599 CAGGGCAGGGCACTGGTGGGTGG - Intronic
1146115828 17:30138010-30138032 CTGGGCAGGGCACTGGGGGAAGG - Intronic
1146380366 17:32323179-32323201 CTCAGCATGGCACTGGTGCAGGG - Exonic
1147325927 17:39669606-39669628 CTGGGCAGGGCAGAGGAAGAGGG - Intronic
1147446296 17:40477222-40477244 GTGGGCAGGGCCCAGGTCGATGG + Exonic
1147988779 17:44321058-44321080 CTGAGAAGGGCACATCTCGAAGG + Exonic
1149385502 17:56139461-56139483 CTGAGCAGGTCACAAGCTGAGGG - Intronic
1149425735 17:56552525-56552547 TTGGGCAGGGCACAGCTGGCTGG + Intergenic
1150125550 17:62632390-62632412 GGGAGCAGAGCGCAGGTGGAAGG - Intronic
1150468858 17:65418721-65418743 AGGAGCAGGGCAGAGGTGGGTGG - Intergenic
1152078313 17:78171704-78171726 CACAGCAGGGTACAGGTGGGTGG - Intronic
1152218721 17:79049217-79049239 CAGAGCAGGGGAGAGCTGGAAGG + Exonic
1152386404 17:79977414-79977436 CTGGGAAGGGGCCAGGTGGAGGG - Intronic
1152581879 17:81169092-81169114 CGGGACAGAGCACAGGTGGAGGG + Intergenic
1152803027 17:82340402-82340424 CTGGGGAGGGCACTGGGGGAGGG - Intergenic
1153029841 18:703315-703337 CTGACTTGGGCACACGTGGAGGG - Intronic
1153236565 18:2994331-2994353 CTGACCAGGGCACAGGTCTGGGG - Intronic
1153239351 18:3016307-3016329 CTGGCCATGGCACAGGTGGTTGG + Intergenic
1153946010 18:10018077-10018099 CTGAGAAGGGCAGAGCTGGCCGG + Intergenic
1154019213 18:10647931-10647953 CAGAGCAGGGCACTGGTGGTGGG - Intergenic
1155946930 18:31863759-31863781 AGGAGCAGGGCAAAGGTGGTAGG - Intronic
1157292558 18:46420297-46420319 CAGAGGAGGGCACAGGAGAAAGG + Intronic
1157376942 18:47175970-47175992 CTGTGCAGGGCCCAGGGGGTTGG - Intronic
1157559449 18:48636366-48636388 CTGTGCTGGGCTCAGGTGAAGGG + Intronic
1158389891 18:57036219-57036241 CTGAGCGGGGCAAAGGGTGAAGG + Exonic
1158679747 18:59556562-59556584 CGCAGCAGGGCACAAGTAGAAGG + Intronic
1159038322 18:63298585-63298607 CAGAGAAGGACAAAGGTGGAAGG + Intronic
1160683203 19:422039-422061 CTTCGCTGGGCACAGGTGGGAGG - Intronic
1160683217 19:422081-422103 CTTCGCTGGGCACAGGTGGGAGG - Intronic
1160869449 19:1270364-1270386 CTGCCCAGGGCACAACTGGAAGG + Intronic
1161135462 19:2617019-2617041 CTGGGCAGCACACTGGTGGAAGG - Intronic
1161338245 19:3726176-3726198 CCAGGCAGGGGACAGGTGGAGGG - Intronic
1161968288 19:7561176-7561198 GGGAGCAGGGCACAGGTGAGGGG - Intronic
1162078533 19:8205209-8205231 CTGGGCAGGGGACAGGTGGCAGG + Intronic
1162725836 19:12689342-12689364 CTGGGCAGGGCACATGGGGCAGG + Intronic
1162767774 19:12930391-12930413 CTGGTCAGGGGGCAGGTGGACGG - Intronic
1163235146 19:16025518-16025540 CTGTCCAGGGCACACGTGTAAGG - Intergenic
1163291081 19:16379364-16379386 CAGAGTGGGGCAGAGGTGGAGGG + Intronic
1163489997 19:17611856-17611878 CTGGGCAGGGCAGGGGAGGATGG + Intronic
1164555411 19:29247243-29247265 CTCAGCAAAGGACAGGTGGAAGG - Intergenic
1164557182 19:29262688-29262710 CAGATCAGGACACAGGAGGATGG + Intergenic
1165152772 19:33770738-33770760 CTAAGCAGCGCCCAGGTAGAGGG - Intronic
1165736645 19:38181084-38181106 CTGAGCTGGGAAGAGGTGGGGGG + Intronic
1165897887 19:39154476-39154498 CTGAGCTGGGCCAGGGTGGAAGG + Intronic
1167310943 19:48737660-48737682 CTGAGCAGGGCCTATGTGGGTGG - Intronic
1167505744 19:49870172-49870194 CATCGCAGGGCACAGGTGGCAGG - Intronic
1168308028 19:55446462-55446484 CGGAGCTGGGGACAGGAGGATGG + Intergenic
1168323073 19:55521784-55521806 CTCTGCAGGCCAGAGGTGGAGGG + Intergenic
1168405475 19:56108237-56108259 CTGGGCAGGGGCGAGGTGGAGGG - Intronic
1168675145 19:58272316-58272338 CAGACCAAGGCCCAGGTGGAAGG + Intronic
926111735 2:10188163-10188185 ATGAGCAGGGCCCAGGTGGCTGG + Intronic
926229666 2:10992880-10992902 CCAAGCAGGGCACAGGGGGTGGG + Intergenic
926302047 2:11611648-11611670 CTGGGCATGGCAGAGGGGGAGGG - Intronic
926395885 2:12441804-12441826 TTGAGCAGGTAACAGGAGGAAGG + Intergenic
927057454 2:19379190-19379212 CTGAGCAGAGCTCAGGAGCAGGG + Intergenic
927705210 2:25292563-25292585 CTGAGCACAGCACAGCTGGGGGG - Intronic
927954455 2:27198933-27198955 CTGGCCAGGGCAGAGGTGAAAGG + Intergenic
929249768 2:39739811-39739833 CTGAGCAAGGAAGAAGTGGATGG + Intronic
929484522 2:42342003-42342025 CTAAGCAGGGGGCAGGTGGGAGG + Intronic
931088128 2:58856644-58856666 CTGAACATGGTACAGGTGCATGG + Intergenic
931209176 2:60176486-60176508 CTGAGCAGAGCACACATGGGGGG + Intergenic
932739207 2:74279003-74279025 CGGCCCTGGGCACAGGTGGAGGG - Intronic
932780391 2:74555356-74555378 CTGAGCAGTGTCCAGGCGGAAGG - Exonic
932860632 2:75287602-75287624 CTGTGCTGAGCATAGGTGGATGG - Intergenic
933240722 2:79917733-79917755 CTGACCCAGGCACAGGTGGTGGG + Intronic
934618881 2:95792137-95792159 CTGAGCCGGGGAAAGGTGCAAGG - Intergenic
934642012 2:96032420-96032442 CTGAGCCGGGGAAAGGTGCAAGG + Intronic
934663104 2:96153591-96153613 GTGGGCAGGGCACTGGTGGGTGG - Intergenic
934770945 2:96907347-96907369 CTGTGCAGGGCACAAGCAGAGGG + Intronic
934840233 2:97619907-97619929 CAGTGCAGGGCAGAGGTGAAAGG - Intergenic
936299771 2:111295695-111295717 CTGAGCAGGCCCCAGGTCCAGGG + Intergenic
936399346 2:112153879-112153901 CGGAGAAGGGCAGGGGTGGATGG + Intronic
936685728 2:114823917-114823939 CAGAGCAGGGCAAGGATGGATGG + Intronic
937217611 2:120322621-120322643 ATGAGAAGTGCTCAGGTGGAGGG - Intergenic
937404332 2:121612621-121612643 CTGGGCAGGACATGGGTGGATGG - Intronic
937429381 2:121825642-121825664 AGGAGCAGGGGACAGTTGGAGGG + Intergenic
937986194 2:127639183-127639205 ATGCGGAGGGCACAGGTGGATGG + Exonic
938255725 2:129858518-129858540 CTGAGCTTGGGAAAGGTGGACGG - Intergenic
938387698 2:130879079-130879101 CTGAGCACAGCACAGGTGGGAGG + Intronic
938696288 2:133838099-133838121 CTGTGCAGTGCACATGAGGATGG - Intergenic
938803942 2:134788588-134788610 CTCAGCGGGGAACAGGTGGGTGG - Intergenic
940063398 2:149598132-149598154 CTGAGCTGAGCACAGGGGTAAGG + Intergenic
941686977 2:168456868-168456890 GAGAGCAGGGCCCAGGAGGAGGG - Intronic
941961109 2:171254781-171254803 CTGTGCAGGGCACAGCAGAAAGG - Intergenic
942064851 2:172261080-172261102 GTGAGGAGGGCACAGTTGGCTGG - Intergenic
942104028 2:172614431-172614453 CAGAGCAGGGCAGAGGATGACGG + Intergenic
942519778 2:176791321-176791343 CTCTGCTGAGCACAGGTGGAGGG - Intergenic
943666562 2:190615436-190615458 CAGGGCAGGGCACATGTGAAGGG + Intergenic
944847369 2:203682151-203682173 CTCACCAGGGCAAAGCTGGAAGG + Intergenic
945191249 2:207189835-207189857 CTGACAAGGGCAGAAGTGGAGGG - Intergenic
946059692 2:216931283-216931305 TTGAGTAGGGCTCAGCTGGATGG + Intergenic
946158506 2:217822114-217822136 CTGAGCAAGGCCCTGGTGAAAGG - Intronic
947016505 2:225626409-225626431 CAGAACAGGACACAGGAGGATGG + Intronic
948605205 2:239130632-239130654 GAGGGAAGGGCACAGGTGGAGGG - Intronic
948860353 2:240749919-240749941 CTGAGCAGGGCCCAGGGGCCAGG + Intronic
1169206057 20:3740920-3740942 CAGAGCAGGGACCAGGTGGTGGG + Intronic
1170253427 20:14312210-14312232 CTGAGCAGGTCTGGGGTGGAGGG - Intronic
1170432266 20:16287013-16287035 TTGGGCAGGGCCCAGCTGGATGG - Intronic
1171451147 20:25237063-25237085 CTGAGGAGGGCCCAGGAGGCAGG + Intergenic
1172106418 20:32519733-32519755 CTGGGCAGGACAGAGCTGGAGGG + Intronic
1172566045 20:35931290-35931312 CTGAGCAGGGGACATATGCATGG + Exonic
1173169365 20:40711311-40711333 GTGAGCTGGGCCCAGGTGGGTGG - Intergenic
1173547148 20:43906689-43906711 CTGAGCTGGGCACTGTAGGATGG - Intergenic
1173623419 20:44453913-44453935 TTGGGCAGGGCAGCGGTGGAAGG - Intronic
1174185604 20:48703823-48703845 CTCAGCAGGGCTGGGGTGGAGGG - Intronic
1175125832 20:56750829-56750851 CAGGTCAGGGAACAGGTGGAGGG - Intergenic
1175515086 20:59564362-59564384 CTGGGCAGGGGACAGAGGGAAGG - Intergenic
1175685881 20:61028644-61028666 CTGTGCAGGGGACAGGTCCAGGG + Intergenic
1175967260 20:62665852-62665874 GTGAGGAGGGCACAGGTGAGGGG - Intronic
1176130754 20:63495833-63495855 GTGAGCAGGGCACAGCAGGCGGG - Intronic
1179556330 21:42179573-42179595 CTGAGCTGGGCACAGGGGCCTGG + Intergenic
1179732132 21:43373864-43373886 CCGAGCAGGGGCCAGGTGGCCGG - Intergenic
1180017109 21:45094612-45094634 CTCAGCAGGGCCCACGTGCAGGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180706045 22:17810584-17810606 CAGAGCAGAGCAGAGGTAGACGG - Intronic
1180794268 22:18594257-18594279 CTGATGAGGGCACAGGTCGGGGG - Intergenic
1181176464 22:21039919-21039941 TTGAGCAGAGCACAGGTGGGTGG - Intergenic
1181227472 22:21401063-21401085 CTGATGAGGGCACAGGTCGGGGG + Intergenic
1181251178 22:21533776-21533798 CTGATGAGGGCACAGGTCGGGGG - Intergenic
1181806046 22:25375062-25375084 CAGAGCAGGACACAGGAGGGTGG - Intronic
1182085272 22:27556927-27556949 CTGTGCTGGGGCCAGGTGGAGGG - Intergenic
1183107157 22:35622771-35622793 CTGTCCAGGTGACAGGTGGATGG - Intronic
1183184101 22:36282083-36282105 CTGTGCAGGGCACAGAAGGCTGG - Exonic
1183194324 22:36343036-36343058 CTGGAGAGGGCACAGGTGGAGGG - Intronic
1183474660 22:38029489-38029511 GTGTGCAGGGCACAGGGGCAAGG + Intronic
1184234811 22:43177487-43177509 ATGAGCAGGAAAAAGGTGGAAGG + Intronic
1184608276 22:45586709-45586731 CTGAGCAGGTGAAAGGTGGTGGG + Intronic
1184777919 22:46632567-46632589 CTGAGAAGGGGTCAGCTGGAGGG + Intronic
1184790063 22:46694806-46694828 GTGTGCAGGGCACTGGTGGCAGG - Intronic
1185132008 22:49044622-49044644 AGGAGCAGGACAAAGGTGGAAGG - Intergenic
1185339783 22:50286117-50286139 GTGAGCAGGGCTGGGGTGGACGG + Intronic
950426805 3:12928680-12928702 TGAGGCAGGGCACAGGTGGATGG - Intronic
950641807 3:14353426-14353448 CTGGGCAGGGGACTGGAGGAGGG - Intergenic
950662937 3:14477823-14477845 GTGAGCAGGGGCCAGGAGGAGGG + Intronic
950987408 3:17389687-17389709 TTGAGCAGGGCTCAGTAGGATGG - Intronic
953133529 3:40163304-40163326 CTGTGGAGGTCACAGGAGGAAGG - Intronic
953910598 3:46890934-46890956 AAGAGGAGGGCACAGCTGGAGGG + Intronic
954631089 3:52047964-52047986 CTGAGCTGGATCCAGGTGGAAGG - Intergenic
955157693 3:56433418-56433440 CTGAGAAGGCCACCAGTGGAAGG + Intronic
961618620 3:128205347-128205369 CTGAGCAGTGCAGAGATGGAGGG + Intronic
961816972 3:129556098-129556120 CTGATCTGGGGACAGGTGGGAGG + Exonic
961845735 3:129761375-129761397 CTTAGCAGGGAAGAGGAGGAGGG - Intronic
962275772 3:134012217-134012239 CTGAGCAGTCCACAGTTAGAGGG + Intronic
963052544 3:141154237-141154259 CAGAGCAGGGCAGAGGAGGAGGG + Intergenic
965501339 3:169459677-169459699 TGGAGCAGGGGACAGGTTGAGGG - Intronic
967938263 3:194746644-194746666 TTGAGGAGGGGACAGGTGGATGG - Intergenic
968233556 3:197017966-197017988 CTGAGCAGGGGGCAGGGGGCAGG + Intronic
968501306 4:951481-951503 CTGGGTTGGGCACAGGTGTAGGG + Intronic
968628340 4:1637917-1637939 CAGAGCCGTGGACAGGTGGATGG - Intronic
968997702 4:3955875-3955897 CTGAGAAGGGCTCAGGAGGCGGG + Intergenic
969112896 4:4854702-4854724 CTGCGCAGGGCAGAGCTGGAGGG + Intergenic
969311476 4:6355238-6355260 CTGATCAGGGCTCAGGGGGCAGG + Intronic
969495884 4:7525924-7525946 CTGAGGAGGGGACAGGTGTGAGG - Intronic
969601900 4:8181790-8181812 CTGAGCAGGGAACAGGGAGGTGG + Intergenic
969607573 4:8210197-8210219 CGCCGCAGGGCACAGGTGGAGGG + Intronic
969617808 4:8263497-8263519 CTGAGCAGTTCACGGCTGGAGGG + Intergenic
969760051 4:9175057-9175079 CTGATCAGCACTCAGGTGGAGGG + Intronic
970195666 4:13547888-13547910 CGGCCCAGGGCACAGGTGGCGGG - Intergenic
971244357 4:24914646-24914668 TTGAGCAAGGCTCAGCTGGATGG - Intronic
973907840 4:55548184-55548206 CTGAGCAGGACACAAGGGGAAGG + Intergenic
976465273 4:85360806-85360828 CTGAGCAGGGTGGTGGTGGAAGG + Intergenic
976904979 4:90226216-90226238 CTGAGCAAGGCTCAGCTGGCTGG - Intronic
979270706 4:118757358-118757380 CTGAGCATGGCAGAGTTCGAAGG - Intronic
981589769 4:146347108-146347130 CAGAGAAGGGTAGAGGTGGAAGG + Intronic
982042125 4:151407604-151407626 CTGAGCTTGTCACAGGTGAAAGG + Intergenic
984126088 4:175812671-175812693 CTGAGCTGTGAACAGATGGAGGG + Intronic
984587196 4:181578135-181578157 GTGAGCAGGGAACAAGTGGAAGG + Intergenic
985392455 4:189504637-189504659 CTGCCCAGGGCAGAGCTGGATGG + Intergenic
986704811 5:10446253-10446275 TTGGGGAGGGCACAGGAGGAAGG + Intronic
986748218 5:10761890-10761912 CTTAGAAGGCCACAGGCGGAGGG - Intergenic
990079866 5:51899641-51899663 CTGAGAAGGGTACAGGGTGAAGG + Intergenic
990313917 5:54566637-54566659 ATGAACATGGGACAGGTGGAAGG - Intergenic
992887827 5:81176572-81176594 CTGATCATTGCACATGTGGACGG + Intronic
993036607 5:82765677-82765699 CAGAGAAGATCACAGGTGGAAGG + Intergenic
994709972 5:103255331-103255353 CTGAGGAGGAGAAAGGTGGAAGG - Intergenic
996945509 5:129062311-129062333 CAGAGCAGGACACAGTGGGATGG + Intergenic
998603907 5:143614464-143614486 TTGACCTGGGCACAGGTGGATGG - Intergenic
999152576 5:149436014-149436036 CTGAGAAGGGGACAGCAGGAAGG + Intergenic
999610765 5:153366981-153367003 ATGTGCAGGGCACAGGTGCATGG + Intergenic
1001150063 5:169219572-169219594 CTGAGCTGTGCAGAGGTGGCAGG + Intronic
1001688487 5:173614457-173614479 CTGATAAGTGAACAGGTGGAGGG - Intronic
1002580660 5:180208079-180208101 CTGTGCAGGCGACCGGTGGAGGG - Intronic
1002791577 6:441367-441389 CTGAGCAGGGGTGAGGTGGGAGG - Intergenic
1003127185 6:3364646-3364668 GCGTGCAGGGCACAGCTGGAGGG + Intronic
1003311336 6:4972097-4972119 TTGAGCAGGGCACAGGCTGAGGG + Intergenic
1003665931 6:8111421-8111443 GTGGGCAGGGCAAGGGTGGATGG - Intergenic
1004017392 6:11744580-11744602 CTGAGATGGGGCCAGGTGGAAGG + Intronic
1005988858 6:30891153-30891175 CTGAGCAGGGGACTGGAGGGTGG + Intronic
1006107813 6:31727305-31727327 CTGAGCAGGACACAGGTACCAGG + Exonic
1006288181 6:33113910-33113932 GTGGGCAGTGAACAGGTGGACGG + Intergenic
1006581887 6:35082127-35082149 CTGTCCAGGGCACTGGTGGAAGG - Intronic
1007223114 6:40294379-40294401 CTGAGCAGTTCACAGGGTGATGG + Intergenic
1007257827 6:40541061-40541083 CAGAGCCAGGCACAGGTGCAGGG + Intronic
1007582333 6:42966883-42966905 ATGAGCAGGGCACAGTAGGCAGG + Intronic
1010108761 6:72199585-72199607 CTGGAGAGGGCAGAGGTGGAGGG + Intronic
1011219128 6:85035604-85035626 TTGAGCAGGGCACATGTTGGGGG - Intergenic
1015628203 6:135204049-135204071 CTCTGCATGGCACAGGGGGATGG - Intronic
1016796937 6:148128206-148128228 CTGGGCAGGACACAGTGGGATGG + Intergenic
1017591921 6:155987218-155987240 CTCAGCAGGGCTGAGGAGGAGGG - Intergenic
1018789259 6:167134041-167134063 CAGAGCATGGCAGGGGTGGAGGG - Intronic
1019215121 6:170438566-170438588 CTGACACGGGCACAGATGGAGGG - Intergenic
1019667500 7:2259184-2259206 CTGTGCAGGTCAGGGGTGGATGG - Intronic
1019686149 7:2383405-2383427 CCCACCAGGACACAGGTGGAGGG - Intergenic
1020370054 7:7422294-7422316 CTTGGAAGGGCACAGGTGAACGG - Intronic
1021115695 7:16744505-16744527 CTGAGCAAGGCCCAGGTGAGGGG - Intergenic
1021906395 7:25338482-25338504 CTGAGCAGGGGAATGGGGGAGGG + Intergenic
1022171612 7:27837315-27837337 ATGAGCAGGGCAAGGGTGGTGGG + Intronic
1022626789 7:32045034-32045056 GGGGGCAGGGCACAGGTGTAGGG - Intronic
1022846073 7:34211165-34211187 CTGACCAGGGAAAAGGAGGAAGG - Intergenic
1023345167 7:39264353-39264375 CTCAGTAGGGCCCAGTTGGATGG - Intronic
1023365357 7:39458189-39458211 CTGAGCAGGGAGCAGGTTGGAGG + Intronic
1023482560 7:40649959-40649981 CTGAGCATGGCTTAGTTGGATGG + Intronic
1023994890 7:45153334-45153356 GGGAGCAGGGCAGAGGGGGATGG + Intergenic
1024251625 7:47509771-47509793 CTGAGCCGGGCCCAGGAGGTGGG - Intronic
1024572337 7:50733657-50733679 CTGATCATGGCAGAGGTGAAGGG - Intronic
1024596633 7:50943422-50943444 CTGAGCAGGGCTGTGGTGGAGGG + Intergenic
1026889372 7:73973246-73973268 CTGAGGAGGGCAGAGGGCGAGGG - Intergenic
1027269687 7:76512750-76512772 CTTAGCAGGGCACATGGGGCAGG - Intronic
1027320399 7:77006645-77006667 CTTAGCAGGGCACATGGGGCAGG - Intergenic
1029236816 7:99126962-99126984 CTGAGCAGGGGCCGGGGGGAAGG + Intronic
1029241993 7:99169638-99169660 CTGGGCAGGGCACAGGAACAAGG - Intergenic
1029386250 7:100245530-100245552 CTGAGCAAGGCAGAGGGGCAGGG - Intronic
1029481226 7:100814124-100814146 CAGTACAGGGGACAGGTGGAGGG + Intronic
1029525473 7:101091276-101091298 ATGTGCAGGGCATAGGTAGAGGG + Intronic
1029851342 7:103464698-103464720 CTGAAGAAGGCCCAGGTGGATGG + Intergenic
1030338166 7:108347873-108347895 CAGGGCAGGGCTAAGGTGGAGGG - Intronic
1032089836 7:128905914-128905936 CAGAGGAGGGCACAGGAGGCAGG - Intronic
1032092409 7:128917617-128917639 CAGAGGAGGGCACAGGAGGCAGG + Intergenic
1032454981 7:132066400-132066422 CTCAGTGGGGCACAGGGGGAAGG - Intergenic
1034741132 7:153474585-153474607 CTGGGCAGGGCCCAGGAGCAAGG - Intergenic
1035059665 7:156059639-156059661 CTGAGCAGGGCACTGAAGGATGG - Intergenic
1035160063 7:156943723-156943745 CTGGGGCGGGGACAGGTGGATGG + Intergenic
1036204461 8:6794816-6794838 CTGGGCAGGACACAGATGCAAGG - Intergenic
1036263672 8:7258788-7258810 CTGATCAGCACTCAGGTGGAGGG + Intergenic
1036264973 8:7266410-7266432 CTGATCAGCACTCAGGTGGAGGG + Intergenic
1036266274 8:7274032-7274054 CTGATCAGCACTCAGGTGGAGGG + Intergenic
1036267575 8:7281654-7281676 CTGATCAGCACTCAGGTGGAGGG + Intergenic
1036268878 8:7289276-7289298 CTGATCAGCACTCAGGTGGAGGG + Intergenic
1036270176 8:7296898-7296920 CTGATCAGCACTCAGGTGGAGGG + Intergenic
1036297712 8:7550157-7550179 CTGATCAGCACTCAGGTGGAGGG - Intergenic
1036299016 8:7557805-7557827 CTGATCAGCACTCAGGTGGAGGG - Intergenic
1036300321 8:7565455-7565477 CTGATCAGCACTCAGGTGGAGGG - Intergenic
1036301627 8:7573099-7573121 CTGATCAGCACTCAGGTGGAGGG - Intergenic
1036302925 8:7580748-7580770 CTGATCAGCACTCAGGTGGAGGG - Intergenic
1036315713 8:7717327-7717349 CTGATCAGCACTCAGGTGGAGGG + Intergenic
1036317022 8:7724975-7724997 CTGATCAGCACTCAGGTGGAGGG + Intergenic
1036318329 8:7732623-7732645 CTGATCAGCACTCAGGTGGAGGG + Intergenic
1036319638 8:7740270-7740292 CTGATCAGCACTCAGGTGGAGGG + Intergenic
1036320945 8:7747918-7747940 CTGATCAGCACTCAGGTGGAGGG + Intergenic
1036322255 8:7755566-7755588 CTGATCAGCACTCAGGTGGAGGG + Intergenic
1036323564 8:7763214-7763236 CTGATCAGCACTCAGGTGGAGGG + Intergenic
1036324860 8:7770861-7770883 CTGATCAGCACTCAGGTGGAGGG + Intergenic
1036351176 8:8013446-8013468 CTGATCAGCACTCAGGTGGAGGG - Intergenic
1036352482 8:8021092-8021114 CTGATCAGCACTCAGGTGGAGGG - Intergenic
1036353775 8:8028740-8028762 CTGATCAGCACTCAGGTGGAGGG - Intergenic
1036513495 8:9422079-9422101 AGGAGCAGGGCCGAGGTGGAGGG - Intergenic
1036690374 8:10941210-10941232 GGGAGGGGGGCACAGGTGGAGGG - Intronic
1036846453 8:12173865-12173887 CTGATCAGCACTCAGGTGGAGGG - Intergenic
1036867816 8:12416184-12416206 CTGATCAGCACTCAGGTGGAGGG - Intergenic
1037833313 8:22201581-22201603 CTGAGCAGGGCCCAGCTGTGGGG - Intronic
1038312663 8:26456539-26456561 CTTTGCAGGGCCGAGGTGGAAGG - Intronic
1038482695 8:27912701-27912723 CTGAGCTGGTCACAGATGCAAGG + Intronic
1038658173 8:29473200-29473222 CTGAGGAGGCCACAGGTGCCTGG - Intergenic
1038691252 8:29765435-29765457 CTGTACAGGGAACAGGTGCAGGG - Intergenic
1039222851 8:35354775-35354797 TTGGGAAGGGCACAGCTGGATGG + Intronic
1039458924 8:37727305-37727327 CAGAGCTGGGCCCAGGAGGAGGG + Intergenic
1040387223 8:46921674-46921696 CAGTGCATGGCACATGTGGATGG - Intergenic
1041163219 8:55065913-55065935 CTAAGAAGGTCACAGCTGGAAGG - Intergenic
1041568489 8:59308558-59308580 CTGATCAATGCACATGTGGAGGG + Intergenic
1041827935 8:62119221-62119243 ATGAGCAGGGCACTGGGTGAGGG + Intergenic
1042143779 8:65706092-65706114 CTGGGCATGGCAGAGGTGGGTGG + Intronic
1043883711 8:85574284-85574306 CTGGGCAGAGCACAGATGCAAGG - Intergenic
1044806197 8:96010730-96010752 CTGGGCAGGGCACAGGCACATGG + Intergenic
1046656589 8:116901287-116901309 CAGGGCAGGGCAGGGGTGGAGGG - Intergenic
1047752409 8:127891749-127891771 CTGACCTGGGCACAGCTGGTTGG + Intergenic
1048263769 8:132967398-132967420 CTGACTTGGGCACAGGTGCAGGG + Intronic
1048507545 8:135034669-135034691 CGCAGCAGGGCACATGTAGAAGG - Intergenic
1048982017 8:139707489-139707511 CTGCCCCGGGCAGAGGTGGAGGG - Intergenic
1048989025 8:139750536-139750558 CTGTGCTGGGCACAGGCTGAGGG + Intronic
1049192385 8:141295500-141295522 CTCAGCAGGGGACAGGTATAAGG + Intronic
1049200645 8:141338707-141338729 CTGAGCAGAGCAGAGGTGAGAGG + Intergenic
1049358086 8:142198605-142198627 CTGGGCTGGGCAGGGGTGGAGGG - Intergenic
1049392768 8:142380610-142380632 CTGGGCAGGGGACAGAGGGAGGG - Intronic
1049447785 8:142639335-142639357 CTGACAGGGGGACAGGTGGATGG + Intergenic
1049503295 8:142979973-142979995 GTGGGGAGGGCACACGTGGAAGG - Intergenic
1049674764 8:143884510-143884532 CTGTGAAGGGCACTGGTGGGAGG - Intergenic
1053101823 9:35377696-35377718 GTGAGCAGGCCACAGTTTGAGGG + Intronic
1053870514 9:42487052-42487074 CTGAGCAGTGGAGAGATGGAAGG + Intergenic
1054241032 9:62613312-62613334 CTGAGCAGTGGAGAGATGGAAGG - Intergenic
1054814713 9:69464078-69464100 CTGGGCTGGGCTCAAGTGGAAGG - Intronic
1055304029 9:74910239-74910261 CTGTGCAGGCCACAGGGGGTGGG - Intergenic
1055379607 9:75691544-75691566 CTGACCAGGAGACAGATGGAGGG - Intergenic
1055805625 9:80089827-80089849 CAGAGCAGGACACAGGTGGTTGG + Intergenic
1057063488 9:92026557-92026579 CCAAGCAGGGCACACGGGGACGG - Intergenic
1058681426 9:107443616-107443638 CTGTGCAGGGCACTGGGGGTGGG - Intergenic
1059427897 9:114232478-114232500 CAGAGCAGGGCACAAGTGCTGGG - Intronic
1059610485 9:115887277-115887299 CTGTTCAAGGCATAGGTGGAGGG + Intergenic
1060548093 9:124472305-124472327 GTGAGAAGGGCACAGGGAGAGGG - Intronic
1060595219 9:124843680-124843702 CTGAGCTGAGCACCAGTGGAAGG - Intergenic
1060597005 9:124854404-124854426 ATGAGCTGGGCACGGGTGCAAGG + Intronic
1061398949 9:130358017-130358039 GCCAGCTGGGCACAGGTGGAGGG + Intronic
1061501429 9:131005013-131005035 TTGACCAAGGTACAGGTGGAAGG - Intergenic
1061593760 9:131615472-131615494 CTGTGCAGGGGACGGTTGGAGGG + Intronic
1061666384 9:132162889-132162911 CTGAGCGGCGCGCAGGTGGGGGG + Intronic
1061826564 9:133261644-133261666 CTGACCAAGGCACTGGTGGCGGG - Intronic
1062129542 9:134885176-134885198 CTGGGCAGGGCACAGGCAGTAGG - Intronic
1062346042 9:136115809-136115831 CGGAGAAGGGCTCAGGTGGGAGG - Exonic
1062359753 9:136182136-136182158 CTGTGCAGGGCGCAGGGAGAAGG - Intergenic
1186530121 X:10286887-10286909 TTGGGCAGGGCTCAGATGGATGG + Intergenic
1188137133 X:26504618-26504640 CTGTGCAAGGCAGAGGTGGTGGG - Intergenic
1188230812 X:27660693-27660715 CTGGGCAGTGCACAGATGTAGGG + Intronic
1189648215 X:43157838-43157860 CTGAGCAGGATAAAGGGGGAGGG + Intergenic
1192677665 X:73215238-73215260 CTGGGGAGGGGAGAGGTGGATGG + Intergenic
1193829400 X:86270383-86270405 CTGAGAATGGAACAAGTGGAAGG + Intronic
1195924525 X:110012523-110012545 CTGAGCAAGGCACATGAGAAAGG - Intronic
1196935644 X:120727997-120728019 CTGGACAAGACACAGGTGGAAGG + Intergenic
1200099856 X:153685026-153685048 CTGGGCTGGGCACAGGTCGCAGG + Intronic
1200137062 X:153880307-153880329 GTGTGCAGGGCACATGTGCAGGG - Intronic