ID: 916723795

View in Genome Browser
Species Human (GRCh38)
Location 1:167505073-167505095
Sequence CACCAGAGGAAGCCCTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 305}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916723795 Original CRISPR CACCAGAGGAAGCCCTTGGA AGG (reversed) Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903239525 1:21973778-21973800 CCCCATAGGAAGCTCTTCGAGGG - Intergenic
903307104 1:22420624-22420646 CACGAGATGGCGCCCTTGGATGG + Intergenic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904596897 1:31652466-31652488 CACCAGAGGAACCCACTGGAAGG + Exonic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905827581 1:41037630-41037652 CAACAGAGAAAGCCCTGGGCAGG + Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907751469 1:57267537-57267559 CTCCAGAGGCTGCCCTTGGGAGG - Intronic
907946645 1:59141728-59141750 ATCCACAGGAAGCCCTGGGAGGG + Intergenic
908012306 1:59791085-59791107 CACCAGTGGCAGGCCTTGGGTGG - Intergenic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909105902 1:71408018-71408040 CACCAAAAAAAGGCCTTGGAAGG - Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910120827 1:83788191-83788213 CACCACAGGAAGCCTCTAGAAGG - Intergenic
910132373 1:83923909-83923931 GATCAGAGAAATCCCTTGGATGG - Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913151321 1:116046921-116046943 CACCACAGGGATCCCTTGGGAGG + Intronic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915041173 1:152969453-152969475 CACCAGAGGAAGGGGTAGGATGG - Intergenic
916648781 1:166816235-166816257 CAGCAGAGGAAGCCCTGGAGAGG + Intergenic
916723795 1:167505073-167505095 CACCAGAGGAAGCCCTTGGAAGG - Intronic
917219749 1:172716344-172716366 CATCAGAGTGAGCCCCTGGAGGG + Intergenic
918707237 1:187680567-187680589 CAACATGGGAAGCCATTGGAGGG + Intergenic
920991644 1:210945542-210945564 CCTGAGGGGAAGCCCTTGGAAGG - Intronic
922018029 1:221672351-221672373 CAACATAGGAAGTCCTTGGGTGG + Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922850393 1:228728289-228728311 CACCAGGGAGAGCCCTTAGAGGG - Intergenic
923402245 1:233626308-233626330 GACCAAAGGAAGGCCATGGAAGG + Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1065962873 10:30748439-30748461 TTTCAGAGGAAGACCTTGGAAGG + Intergenic
1066441358 10:35442229-35442251 CACCACCATAAGCCCTTGGAGGG - Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069156704 10:65038289-65038311 CACCAGTGGAAGTCCCTGGCTGG + Intergenic
1069739647 10:70679314-70679336 CCCCAGAGGAAGCACTTTGCAGG - Intronic
1070823739 10:79379231-79379253 CACAGGAGGCAGCCCCTGGAAGG + Intergenic
1070916948 10:80161111-80161133 CAAAAGAGGAAGCCAGTGGAGGG - Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1075056438 10:119222374-119222396 CAGCACAGGCAGCACTTGGAGGG - Intronic
1075167217 10:120079503-120079525 CACAAGGGGAAGCCCTAAGAAGG + Intergenic
1076493756 10:130883145-130883167 TACCCCAAGAAGCCCTTGGATGG - Intergenic
1076818161 10:132924726-132924748 CACCTGCGGAAGCCCCTGGCTGG - Exonic
1076983132 11:215871-215893 CACTAGAGGAAGCCCTGGCGAGG + Exonic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078758707 11:14234635-14234657 CACCGGAGGCAGCCCTTGGGCGG + Intronic
1079367276 11:19820289-19820311 TACCAGAGGAAGCACTTGGAAGG + Intronic
1080423776 11:32137865-32137887 CTTGAGAGAAAGCCCTTGGATGG - Intergenic
1083125269 11:60559438-60559460 CAACAGAGGCTGCCTTTGGAGGG - Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085747718 11:79129253-79129275 CACCAGAGGGATCCATTGGGAGG + Intronic
1087483261 11:98729181-98729203 CATGAGAGGAAGCATTTGGATGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091304576 11:134529467-134529489 GACCAGAGGAAGCCGCTGGTAGG - Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093157707 12:15707599-15707621 TACCAGAGGAAGACTTCGGAAGG - Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1096587237 12:52630650-52630672 CAGCAGTGGTAGCCTTTGGAGGG - Intergenic
1097438280 12:59577427-59577449 CACCAAAGTATGCCCTTGGCAGG - Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1099369395 12:81811629-81811651 GACCAGAGGGAGCCCCTGGGGGG + Intergenic
1099939949 12:89174749-89174771 CCTCAGAGGATGCTCTTGGAGGG + Intergenic
1101331571 12:103761661-103761683 CACCAAAGGAAGCGCTGGAAGGG + Intronic
1102556186 12:113728162-113728184 CTCCAGAAGATTCCCTTGGATGG - Intergenic
1103567331 12:121823198-121823220 CAGCAGGGGCCGCCCTTGGAAGG + Exonic
1104159241 12:126162753-126162775 CTGCAAATGAAGCCCTTGGACGG + Intergenic
1105403364 13:20114521-20114543 CACCTGACCAACCCCTTGGAAGG + Intergenic
1111533800 13:89575334-89575356 CACCAGACAAACCCCTTAGATGG - Intergenic
1112308306 13:98295312-98295334 CAGCAGAGGGAGCCCTGGGCAGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114423885 14:22606413-22606435 CACCAGACCAGGCCCTGGGAGGG - Exonic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1117051112 14:51860475-51860497 CACCAGAGTAAGCCCTGAAATGG + Exonic
1119333925 14:73816589-73816611 AACCAGAAGATGACCTTGGAAGG + Intergenic
1119706585 14:76786695-76786717 CAACAGAGGTAGGCCTAGGAAGG + Intergenic
1122488539 14:102097549-102097571 AACCAGAGGTTGCCCTTGGGGGG - Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122987608 14:105219763-105219785 CACCAGGGGCAGCCCCTCGAGGG - Intronic
1124992075 15:34685023-34685045 CACCAGAGAAGGCTCATGGAAGG + Intergenic
1125534964 15:40437453-40437475 CATCATAGGAAGCCCCTGGGGGG - Intergenic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128063116 15:64747687-64747709 GACCAGAGGAAGCGCCTGCATGG + Intronic
1128643548 15:69358478-69358500 CACCAGAGGCTGCCCCTGGACGG - Intronic
1130011792 15:80158013-80158035 CACCAGAAAAAGCCCCTGGCTGG - Intronic
1130898933 15:88192561-88192583 AGCCAAAGGAAGCCATTGGAGGG - Intronic
1130996769 15:88908521-88908543 CAGCGGAGGAAGCCCTCAGAGGG - Intronic
1132208211 15:100001055-100001077 CACCAGAAGGTGCTCTTGGATGG + Intronic
1132896118 16:2230151-2230173 CACCAGAGGGAGCACTGGGGAGG - Intronic
1133555573 16:6903702-6903724 CAGCAGAGCAAGCACTGGGAGGG + Intronic
1133907018 16:10031670-10031692 CACCAGAGGATGCTTCTGGAAGG + Intronic
1133915887 16:10109447-10109469 AACCAGAGGAAGCCATTATAAGG + Intronic
1134098925 16:11438004-11438026 CACCAGTGGAAGATCTTGGGTGG - Intronic
1135138640 16:19903315-19903337 AGCCAGGGGAAGGCCTTGGAGGG + Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137611820 16:49823154-49823176 AACCTGAGCCAGCCCTTGGATGG + Intronic
1139450741 16:67026714-67026736 CTCAAGAGGAGGCCCTTGGTTGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140123389 16:72101811-72101833 CACCAGAGGAAGCAGTGTGAGGG - Intronic
1141036820 16:80633717-80633739 CGCCTGAGGAAGCCCTAGGGGGG - Intronic
1141591682 16:85073448-85073470 TATCACAGGAAGCCCTTGGTAGG + Intronic
1141761834 16:86033619-86033641 AACGAGAGGAAGGCCATGGATGG - Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143461438 17:7106957-7106979 GGCAGGAGGAAGCCCTTGGAAGG - Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1148189975 17:45671721-45671743 TACCATAGGCAGCCCTTGGAGGG + Intergenic
1148495501 17:48051287-48051309 AACCTGAGGAATACCTTGGATGG + Exonic
1148573537 17:48690519-48690541 CCCCAGAGGAACCCTGTGGAGGG - Intergenic
1148573646 17:48691586-48691608 CCCCAGAGGAACCCTGTGGAGGG - Intergenic
1149024663 17:52012892-52012914 CAGCAGAGGAAGCCCTCTCAGGG - Intronic
1150245661 17:63672998-63673020 CAACAGAGGAACCCAGTGGAAGG - Intronic
1151311213 17:73293465-73293487 GACCAGAGGCTGCCCCTGGAAGG - Intronic
1151479206 17:74360470-74360492 CCCAAGAGGATGCTCTTGGAAGG + Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152313063 17:79562679-79562701 CGCCAGAGAAAGTCCATGGAGGG + Intergenic
1152663363 17:81553071-81553093 GACCAGAGAACGCCCGTGGAGGG + Intronic
1156022493 18:32616082-32616104 CACCTGAAGAAGCTCTTGTAAGG - Intergenic
1157522199 18:48352907-48352929 CACCAGTGGTAGCCCTGGGCAGG + Intronic
1158534196 18:58292485-58292507 CAGCCCAGGGAGCCCTTGGATGG - Intronic
1158575196 18:58631342-58631364 CCCCAGAGGAACCCTGTGGAGGG + Intergenic
1159962790 18:74568490-74568512 GGCTAGAGGAAGCCCTTGGGAGG + Intronic
1161631703 19:5360111-5360133 CACTGGAGGAGGCCCGTGGAAGG - Intergenic
1162155867 19:8677628-8677650 TCCCAGAGGAAGCCCTCAGAGGG - Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162759232 19:12878754-12878776 CAGCAGAGGAGGCCGGTGGAGGG + Exonic
1162791591 19:13065839-13065861 CACCAGAAGAACTCCCTGGAGGG + Intronic
1163279268 19:16305468-16305490 CATCAGAGGAAGCTGGTGGAAGG + Intergenic
1164128881 19:22343860-22343882 CACCAGAGAAAGCCCTCAGGTGG + Intergenic
1164542441 19:29131002-29131024 GACCAGAGAAAGCCCTAGGAAGG + Intergenic
1165032119 19:33005573-33005595 AACCAGAGGAACCAGTTGGATGG - Intronic
1165689526 19:37852659-37852681 CACCAGAGGAAACTTTGGGAAGG - Intergenic
1165822002 19:38682682-38682704 AAGAAGAGGAAGCCTTTGGAGGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167116837 19:47493332-47493354 CACCAGAGGACTCCCCTGGTGGG + Intronic
1167554043 19:50181819-50181841 CAACAGAGAAAGACCCTGGAGGG - Intergenic
1167894880 19:52572698-52572720 GAACACAGGAAGCCCATGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168411734 19:56144439-56144461 CATCACAGGAAGCAGTTGGAGGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
926052503 2:9753891-9753913 CAGCAGAGGCAGCCGTGGGAGGG + Intergenic
926121308 2:10242649-10242671 GACCAGAGGAAGCTCCTGGAGGG - Intergenic
926761193 2:16280417-16280439 GTCCTGAGGAAGCCCTTCGAGGG + Intergenic
926787209 2:16530262-16530284 CACCATGGGAAGCCCTAGGAAGG + Intergenic
927040505 2:19226057-19226079 CACCAGAGGCAGGCCTGGGATGG + Intergenic
927293573 2:21427829-21427851 CACCACAGGAAGCCGTTTAAAGG - Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928089766 2:28366987-28367009 CACATGAGGAAGGCCTGGGAGGG - Intergenic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929580608 2:43079712-43079734 CACCAGAGAGAGCCATGGGATGG + Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
929953909 2:46440668-46440690 CACCAGAGGAAGCTCCAGAACGG + Intronic
930007556 2:46910181-46910203 CTACAGAGCAAGCTCTTGGAGGG + Intronic
930486584 2:52018246-52018268 CACCACAGGAATCCATTGGGAGG - Intergenic
930837686 2:55811967-55811989 CACCAGAGGAATCCCAGGGAGGG - Intergenic
931239215 2:60437641-60437663 CTTCAAAGGAAGCACTTGGAGGG + Intergenic
931697025 2:64879023-64879045 CACCAGAGGCAGAGCATGGAAGG + Intergenic
932130806 2:69185602-69185624 TTCCATAGGAAGTCCTTGGAGGG + Intronic
932577304 2:72969871-72969893 CACCCCAGGAATCCCTTGGGAGG - Intronic
932591234 2:73069126-73069148 AAGCAGGGGAAGCCATTGGAGGG + Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
937345878 2:121124986-121125008 CACCAGAGGAGGACCCTGCATGG + Intergenic
937757551 2:125558653-125558675 TACCAGACCAAGCCCTTTGATGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
939884295 2:147664458-147664480 CCCCAGAGGCAGCCCCTGAAAGG - Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
942870390 2:180727515-180727537 CCCCAGAGGAAGCCCTGGTCAGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945280587 2:208031845-208031867 CCCCAGAGGAGGCCTGTGGAGGG - Intergenic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946371831 2:219285820-219285842 CCCCAGAGGGAGGCCTAGGAGGG + Exonic
947799533 2:232920159-232920181 CACCAGAGGAATCGCTGGCAGGG - Intronic
948684477 2:239661606-239661628 GCCCTGAGGAAGCCCTGGGAAGG - Intergenic
948900885 2:240956417-240956439 CACCAGAGGAAACTCTCGGCAGG + Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169158419 20:3354459-3354481 CAGCAGAGGCAGCTCTTGGGTGG + Intronic
1170499150 20:16956993-16957015 TAGGAGATGAAGCCCTTGGAGGG + Intergenic
1173566083 20:44039586-44039608 GAACCCAGGAAGCCCTTGGAGGG + Intronic
1175032615 20:55970825-55970847 CACAAGAGGAAGCTCCAGGAGGG - Intergenic
1175136055 20:56825128-56825150 CTCCAAAGCAAGCCATTGGATGG - Intergenic
1175575578 20:60058244-60058266 CACCAGAGCAAACCCTGGGAGGG + Intronic
1176017908 20:62946164-62946186 CTCCAAAGGACGCCCTTGGATGG - Exonic
1179244228 21:39616680-39616702 CACCAAAGGAAGCTCTGGGAAGG - Intronic
1179528828 21:42003853-42003875 GGCCAGGGCAAGCCCTTGGAAGG - Intronic
1179548557 21:42127996-42128018 CACGGCAGGCAGCCCTTGGACGG + Intronic
1179635744 21:42707581-42707603 CAGCCCAGGAAGCCCTGGGAGGG - Intronic
1180017033 21:45093752-45093774 ATCCAGAAGAAGCCCTTGGCCGG - Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182896918 22:33866683-33866705 CACCAGATGGAGCCCTAGAATGG + Intronic
1183620301 22:38968205-38968227 AACCAGAAGGAGCCCCTGGAGGG - Intronic
1183948751 22:41341011-41341033 CATAAGGGGAAGCCCTAGGAAGG + Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184665447 22:45986674-45986696 CACCAGAGGTGGGCCCTGGATGG + Intergenic
1185301789 22:50084695-50084717 CTCCACACTAAGCCCTTGGAGGG - Intronic
950001387 3:9659208-9659230 CAACAGAGGAAGACCTTGTTGGG + Intronic
951962994 3:28349246-28349268 CACCAGAGGGCGCCCCTGAAGGG - Intronic
952723471 3:36557367-36557389 TCCCTGGGGAAGCCCTTGGAGGG - Intergenic
954107159 3:48415580-48415602 CACCTGAGGAAGCTCTTGGTGGG + Exonic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
956138855 3:66125889-66125911 CAAGATAGGAAGCCTTTGGAGGG - Intergenic
957926968 3:86826873-86826895 AAAGAGAGGAAGCCCCTGGAGGG + Intergenic
958842006 3:99217558-99217580 GACAAGAGGAAGCCACTGGAGGG - Intergenic
959046908 3:101484765-101484787 CACCACAGGAATCCATTGGGTGG + Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960165151 3:114393034-114393056 CACCAGAGGAAAACCTTGGTAGG + Intronic
960414537 3:117368394-117368416 CACATAAGGAGGCCCTTGGAAGG + Intergenic
960673222 3:120171532-120171554 CTGCAGAGGAAGCCCTTCAATGG - Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961332211 3:126149088-126149110 CACCAGAAGCTGCCTTTGGACGG + Intronic
961464549 3:127073305-127073327 CAGGAGAGGAAGGCCTAGGAGGG - Intergenic
962375463 3:134855357-134855379 GACCAGAGGCAGCCCATGCAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
966950327 3:184811455-184811477 CACCAGAAGATACTCTTGGAAGG - Intergenic
967253445 3:187566232-187566254 CACCGCAGGAAGCTCTGGGAAGG - Intergenic
967969779 3:194990440-194990462 CACCAGAGGAAGTCGTTGACAGG - Intergenic
968082277 3:195854749-195854771 CAGCAGAGGCAGCTCTGGGAAGG + Intergenic
968121789 3:196130999-196131021 GACCAGAGGCAGACGTTGGAGGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968884601 4:3320963-3320985 GAGCAGAGGAGGCCCCTGGAGGG + Intronic
969317682 4:6391743-6391765 CAGCAGGGGAAGCCCTGGGTGGG + Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973979572 4:56296706-56296728 CAACACAGGCAGCACTTGGAGGG - Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982095980 4:151923900-151923922 CCACAGAGCAAGCCCTTGGCGGG - Intergenic
983489923 4:168376792-168376814 CAGGAGAGCAAGCTCTTGGAAGG + Intronic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
984767276 4:183409171-183409193 CACAAGACAGAGCCCTTGGAGGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
989197839 5:38733347-38733369 CCCCAGAGGAAAGCCCTGGATGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
993604587 5:89972890-89972912 CAGCAGAGGAAGCATTTGAATGG - Intergenic
994526548 5:100912798-100912820 CTCCTCAGAAAGCCCTTGGATGG - Intergenic
995473100 5:112523725-112523747 CACCACAGGGATCCATTGGAAGG - Intergenic
997296584 5:132772583-132772605 CAGCAAATGAAACCCTTGGAGGG + Intronic
997834809 5:137183669-137183691 CACTAGAGGCAGCCCAGGGAAGG + Intronic
997891611 5:137682019-137682041 CCCCAGAGAAAGCCCTTGCCTGG - Intronic
997891738 5:137683084-137683106 CCCCAGAGAAAGCCCTTGCCTGG + Intronic
997962403 5:138332381-138332403 CACCAAACAAAGCTCTTGGAAGG - Intronic
999484957 5:151985795-151985817 CACCACAGGAATCCTTTGGGAGG - Intergenic
1000756917 5:165172905-165172927 CAGCAGAGAAAGGACTTGGAGGG - Intergenic
1001316403 5:170644092-170644114 CAGCAGAGGAAGCCCATAGAGGG + Intronic
1001673504 5:173493388-173493410 AAAGAGAGGAAGCCTTTGGAAGG + Intergenic
1002453832 5:179334257-179334279 CACCATGGGAAGCCCTCGTAGGG - Intronic
1003623994 6:7726725-7726747 CACCAGGAGAACCGCTTGGAGGG - Intergenic
1004072254 6:12311293-12311315 CAACAGAGGGAGTCCTTGTAAGG + Intergenic
1004118403 6:12794353-12794375 AAGCAGAGGAAGTACTTGGATGG + Intronic
1004517433 6:16332286-16332308 CACCAGAGGGCGCCCCAGGATGG + Intronic
1005048361 6:21663369-21663391 AGCCACAGGAAGCCCTTGAATGG + Intergenic
1006451751 6:34109423-34109445 CTCCAGAGGCAGCCCCTGCAGGG - Intronic
1007321391 6:41031015-41031037 CACCAGGGGAAGTCCTGGGTGGG + Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009812658 6:68689015-68689037 TACCTGAGGAAACCCTTAGAGGG + Intronic
1011732356 6:90278350-90278372 CACCAGAGGAATGCCTTGGCTGG - Intronic
1013938510 6:115630817-115630839 CAGCAGAGGAAGCCTGTGTATGG + Intergenic
1017929322 6:158938764-158938786 AAGCAGAGGAACCCCTTAGAGGG + Intergenic
1018163206 6:161068222-161068244 CAACAGAGGAAGCATTTGCAAGG + Intronic
1018923850 6:168193577-168193599 AACCAGGGGACGCCCTGGGACGG + Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019719664 7:2560362-2560384 AAACAGAGGAAGCCTTTGGAAGG + Intronic
1020241219 7:6396637-6396659 CACCATATGAAGTCCTTGGGAGG + Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1024640677 7:51326254-51326276 CACCAGGGGAAGCTTTTGGCTGG - Intergenic
1024928304 7:54641563-54641585 CACCAGTGGGAGGCATTGGAGGG - Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026502706 7:70956616-70956638 CATCACAGGAAGCCATTAGAGGG + Intergenic
1027756771 7:82223843-82223865 GACCAAGGGAAGCCATTGGATGG - Intronic
1028318552 7:89434293-89434315 CCCAAGAGCAAGCCCTTGGTTGG - Intergenic
1032513725 7:132491960-132491982 CACCCCAGGCTGCCCTTGGAAGG - Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034385418 7:150737034-150737056 GACCAGAACAAGCCCTTGCAGGG - Intronic
1034587561 7:152108540-152108562 TTGCAGAGGAAGCCCTGGGAGGG + Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1037127294 8:15366518-15366540 GACCAGAGGAATCTCATGGAGGG + Intergenic
1038150494 8:24939130-24939152 CACCATGGGAAGCCCTGGGAGGG - Intergenic
1038307353 8:26416866-26416888 CAGCTAAGGAAGCCCTGGGAAGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1040873447 8:52124827-52124849 CAGCAGATGAAGGCCTTGGAAGG + Intronic
1042817579 8:72894401-72894423 TGTGAGAGGAAGCCCTTGGAGGG + Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047655225 8:126970047-126970069 AAGCAAAGGAAGCCCTTTGAGGG - Intergenic
1047757806 8:127932018-127932040 CAACAGAGGAAGCCTGAGGATGG - Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1052731549 9:32291666-32291688 CACCACAGGAATCCATTGGGAGG - Intergenic
1052831755 9:33221470-33221492 CACAAGAGGAAGCGCAGGGAGGG - Intronic
1056959893 9:91113907-91113929 CACCTGAAGCAGCTCTTGGATGG - Intergenic
1058456641 9:105143725-105143747 CATGAGAGGAAGCCGATGGAAGG - Intergenic
1060661900 9:125409359-125409381 CACCCCAGGGAGCCCCTGGAGGG + Intergenic
1061364567 9:130165183-130165205 CCACAGACTAAGCCCTTGGAAGG + Intergenic
1062002728 9:134224987-134225009 GCCCAGGGGAAGCCCCTGGATGG + Intergenic
1062401952 9:136376679-136376701 CACCAGAGGGATGGCTTGGATGG - Intronic
1186250026 X:7655876-7655898 CACTGGAGGAAGTGCTTGGAAGG + Intergenic
1188346500 X:29072890-29072912 AACCCGAGGAAGGCCTGGGAGGG + Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188379353 X:29472101-29472123 CACCAGAGAAAGCCATTTTAGGG - Intronic
1188441485 X:30218297-30218319 CACCATAGTAAGCCCAAGGAAGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1196553049 X:117053236-117053258 AACCAGAAGGAGCCCTTGAAAGG - Intergenic
1196581474 X:117384058-117384080 TTCAAGTGGAAGCCCTTGGAAGG - Intergenic
1199537294 X:148917196-148917218 CACCAGAAGAATCACTTGGAGGG - Intronic
1202042314 Y:20698196-20698218 CAGCAGTGAAAGCCCCTGGAAGG + Intergenic