ID: 916725094

View in Genome Browser
Species Human (GRCh38)
Location 1:167516519-167516541
Sequence TCTATGTGCGGCCTTTCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 87}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916725094 Original CRISPR TCTATGTGCGGCCTTTCCTC CGG Intronic
901643529 1:10704927-10704949 GCCATGTCCTGCCTTTCCTCAGG - Intronic
903862875 1:26375614-26375636 TCCCTGAGCGGCCCTTCCTCCGG + Intergenic
912227015 1:107745443-107745465 TCTTTGTTCAGCCTTTCCTATGG + Intronic
915705379 1:157838866-157838888 TCTCTGTGCACCCTTTCCTTGGG + Intronic
916725094 1:167516519-167516541 TCTATGTGCGGCCTTTCCTCCGG + Intronic
921507206 1:215986551-215986573 TCTATGTGCTGTCTTTCATTAGG + Intronic
1069906397 10:71734993-71735015 TCTCTGTGCTTCCCTTCCTCGGG + Intronic
1070390743 10:75968246-75968268 TCTATGAGCAGCCACTCCTCCGG - Intronic
1073540741 10:104314873-104314895 TCTATGAGCGACACTTCCTCAGG - Exonic
1077757197 11:5045184-5045206 TATATGTTCTGCCTTTCCTATGG + Intergenic
1080421490 11:32115136-32115158 TCTTTGGGCAGCCTTTCCTCAGG + Intergenic
1081111397 11:39138064-39138086 TCTATGTCTCTCCTTTCCTCTGG - Intergenic
1081499044 11:43647198-43647220 TCTGTTTGGGGCCTTTACTCAGG + Intronic
1089127666 11:116188677-116188699 TATATGTGCAGGCATTCCTCAGG - Intergenic
1089154604 11:116391505-116391527 TCAATGTACTACCTTTCCTCTGG - Intergenic
1092231965 12:6780968-6780990 TCTCTGTGGGGTCTCTCCTCAGG + Intergenic
1092683405 12:11014782-11014804 TGGATGTGTGTCCTTTCCTCTGG - Intronic
1092687667 12:11069965-11069987 TGGATGTGTGTCCTTTCCTCTGG - Intronic
1096388424 12:51210971-51210993 TATCTGTGCAGACTTTCCTCTGG + Intronic
1096417783 12:51428509-51428531 TCTATGTTGTGCCTTTGCTCAGG + Intronic
1114149025 14:20014399-20014421 TTTATGTGCGGCCTTTCAGTAGG - Exonic
1114259888 14:21028976-21028998 TCTCTCTTCGGCCTTTTCTCTGG - Intronic
1115293938 14:31804616-31804638 TAGATGTGCGGCCTTACTTCTGG - Intronic
1116895469 14:50311804-50311826 TCTATACACTGCCTTTCCTCCGG + Intronic
1117801001 14:59444924-59444946 AATATGTGCTGCCTTTCCTTTGG + Intronic
1117951162 14:61083580-61083602 TCCTTGCGTGGCCTTTCCTCTGG - Exonic
1120442177 14:84555821-84555843 TCTAAGTGTGGCCTTTTCCCAGG + Intergenic
1132163442 15:99564387-99564409 TCTATGTGCCGCCTTTGTTTTGG + Intergenic
1134435706 16:14254405-14254427 TCTTTGTGCTGCTTTTACTCTGG + Intronic
1136019783 16:27432746-27432768 TCTAGGAGGGGGCTTTCCTCAGG - Intronic
1138646654 16:58430461-58430483 TCTGTGTGCAGGCTTTACTCTGG + Intergenic
1139961657 16:70721516-70721538 TCTCTGTGGGGATTTTCCTCAGG + Intronic
1140294832 16:73698732-73698754 TCTATCTGTGACATTTCCTCAGG - Intergenic
1141259364 16:82438752-82438774 TTTCTGTGCGTCCTTTTCTCTGG + Intergenic
1144354727 17:14434436-14434458 TCTAAGTCCTGCCCTTCCTCAGG - Intergenic
1147661961 17:42121494-42121516 TCAATGTGGGGCCTTCACTCAGG - Exonic
1157817149 18:50737898-50737920 TCTTTGTGCAGCCATTCCTCAGG - Intergenic
1157817335 18:50739228-50739250 TCTTTGTGCAGCCATTCCTCAGG - Intergenic
1158929293 18:62306231-62306253 CCTATGTGCTGTCTTTCCTCAGG - Exonic
1159193073 18:65073472-65073494 TCTATGTGAGTTCCTTCCTCAGG - Intergenic
930722320 2:54649370-54649392 TCTCTGTGCACCCCTTCCTCCGG + Intronic
934125644 2:88886544-88886566 TCTATGTGCCTCCTTGACTCTGG + Intergenic
936689705 2:114872014-114872036 TGTATTTGCAGCCATTCCTCTGG - Intronic
936916656 2:117646461-117646483 TCTATTTGAGACTTTTCCTCAGG - Intergenic
941720584 2:168808277-168808299 TCTATGTGCAGACTATCCTGTGG + Intronic
944936457 2:204574045-204574067 CCTATTTGTGGCCTTTCTTCTGG + Intronic
948198792 2:236114613-236114635 CCTGTGTCCTGCCTTTCCTCCGG + Intronic
1170723941 20:18908944-18908966 TGTCTGTGCGGACTTTCCTTGGG + Intergenic
1174748610 20:53089239-53089261 TCTCTGTGTGGGCTTTCCTCAGG - Intronic
1175055994 20:56198803-56198825 TCTATATTCCCCCTTTCCTCAGG - Intergenic
1175588501 20:60167348-60167370 TTTAGATGCTGCCTTTCCTCAGG - Intergenic
1178897164 21:36568438-36568460 TCTATGGGCAGTCTTTGCTCTGG + Intronic
1181929780 22:26391329-26391351 TCCATCTGCAGTCTTTCCTCTGG + Intergenic
1181966988 22:26663646-26663668 TCTTTGTGCGGCCTTTGATCTGG + Intergenic
1185106881 22:48876228-48876250 TTTATTTCCAGCCTTTCCTCCGG - Intergenic
1185212070 22:49575930-49575952 TCACTGTGCTGCCTGTCCTCGGG - Intronic
950932666 3:16806133-16806155 TCTCTGTGTGGTCTTTCATCTGG - Intronic
951577303 3:24126947-24126969 CCTCTATGCGGCCTTTCCTCCGG - Intronic
952308496 3:32166865-32166887 GCCATGTGCAGCCTTTCCTGAGG + Exonic
955630881 3:60973487-60973509 TCTCTGTGGCTCCTTTCCTCTGG + Intronic
962047168 3:131772807-131772829 TCTATGTCCAGGCTTTCCCCAGG - Intronic
962927417 3:140007791-140007813 TTTATGTGAGCCCCTTCCTCTGG + Intronic
963592745 3:147283838-147283860 TTTATTTGCTGGCTTTCCTCTGG + Intergenic
966455252 3:180107707-180107729 TCAGTGAGGGGCCTTTCCTCAGG + Intergenic
970433848 4:16014096-16014118 TAAACGTGCAGCCTTTCCTCTGG + Intronic
980265269 4:130507039-130507061 TCTATGTCTGGCCTTTACACAGG - Intergenic
983640890 4:169943046-169943068 TCTCTGTCCTGACTTTCCTCTGG + Intergenic
986100742 5:4608449-4608471 TATATGTGCAGCCTTTTTTCTGG - Intergenic
989045015 5:37266324-37266346 TCTATGTGGCACCATTCCTCGGG - Intergenic
989307368 5:39973661-39973683 TCTATATGGCGCCATTCCTCAGG - Intergenic
995065314 5:107855394-107855416 CTTATGTGCTGCCTTTGCTCTGG - Intergenic
997063774 5:130538937-130538959 TCTATTTGCCCCCTTTCCTGTGG - Intergenic
1005410226 6:25537575-25537597 TCTACGTGCTGCATTTCCTAAGG + Intronic
1008603431 6:53117512-53117534 TCTAGGTGTGTCCTTTCCTTAGG - Intergenic
1009996731 6:70904131-70904153 ACTATATGAGGCCTTTTCTCTGG - Intronic
1013930347 6:115522941-115522963 ACTATGAGAGGCATTTCCTCTGG + Intergenic
1017024085 6:150166493-150166515 TCTTTGTTCCTCCTTTCCTCTGG + Intronic
1018373036 6:163186161-163186183 TCGTTGTGTGGCCTTTTCTCTGG + Intronic
1018927169 6:168214570-168214592 TCTGTGACCGGCCTTTCCTTGGG + Intergenic
1019887830 7:3920629-3920651 TTTAAGTGCCGCCTTGCCTCCGG - Intronic
1022820293 7:33953215-33953237 CCTCTGTGTGGCCTTGCCTCTGG - Intronic
1024726977 7:52209027-52209049 TGATTGTGCTGCCTTTCCTCTGG - Intergenic
1034098885 7:148435158-148435180 TTTATCTGAGGTCTTTCCTCAGG - Intergenic
1034946137 7:155263172-155263194 TCTGGGTGCAGCCTTTGCTCGGG + Intergenic
1036453408 8:8889269-8889291 TCTTTGAGGGGCGTTTCCTCGGG - Intronic
1038466788 8:27772145-27772167 TCCATCTGCGGCCTTTGTTCTGG - Intronic
1041210981 8:55550486-55550508 TGGATGTGCGGCCTTACTTCTGG - Intergenic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1044298676 8:90557727-90557749 TCTATTTGCAGCCTTTCAACTGG - Intergenic
1052933272 9:34073012-34073034 GCCATGTGTGGCCTTTCCCCGGG - Intergenic
1057296554 9:93847999-93848021 TCTATGTGCCGCCTCTCCCCTGG + Intergenic
1060237102 9:121872193-121872215 TCTTTGTGCCTGCTTTCCTCTGG + Intronic
1185537217 X:871920-871942 TCCATATGCTGCCTTTCCCCTGG + Intergenic
1193818651 X:86134613-86134635 TCAATATGAGGCCTTTACTCTGG - Intergenic
1197327045 X:125106835-125106857 TATAAATGAGGCCTTTCCTCAGG - Intergenic
1199496844 X:148461682-148461704 ACTATGTTCAGTCTTTCCTCTGG + Intergenic