ID: 916726243

View in Genome Browser
Species Human (GRCh38)
Location 1:167526493-167526515
Sequence TGCTCCCAAGGGGCCCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916726234_916726243 19 Left 916726234 1:167526451-167526473 CCAACGTGCTTCAGGTGAGCTGG No data
Right 916726243 1:167526493-167526515 TGCTCCCAAGGGGCCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916726243 Original CRISPR TGCTCCCAAGGGGCCCTCCC AGG Intergenic