ID: 916727995

View in Genome Browser
Species Human (GRCh38)
Location 1:167540451-167540473
Sequence TGGAGTAAATGCAGCTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 1, 2: 2, 3: 16, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916727995_916727998 5 Left 916727995 1:167540451-167540473 CCTGCTGAGCTGCATTTACTCCA 0: 1
1: 1
2: 2
3: 16
4: 150
Right 916727998 1:167540479-167540501 TAACCCAGAGCATTATTCCTAGG 0: 1
1: 0
2: 0
3: 9
4: 155
916727995_916728003 17 Left 916727995 1:167540451-167540473 CCTGCTGAGCTGCATTTACTCCA 0: 1
1: 1
2: 2
3: 16
4: 150
Right 916728003 1:167540491-167540513 TTATTCCTAGGGGCTTGATTTGG 0: 1
1: 1
2: 2
3: 9
4: 107
916727995_916727999 6 Left 916727995 1:167540451-167540473 CCTGCTGAGCTGCATTTACTCCA 0: 1
1: 1
2: 2
3: 16
4: 150
Right 916727999 1:167540480-167540502 AACCCAGAGCATTATTCCTAGGG 0: 1
1: 0
2: 1
3: 12
4: 102
916727995_916728000 7 Left 916727995 1:167540451-167540473 CCTGCTGAGCTGCATTTACTCCA 0: 1
1: 1
2: 2
3: 16
4: 150
Right 916728000 1:167540481-167540503 ACCCAGAGCATTATTCCTAGGGG 0: 1
1: 0
2: 1
3: 12
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916727995 Original CRISPR TGGAGTAAATGCAGCTCAGC AGG (reversed) Intronic
903779791 1:25813980-25814002 TGGAGGAACTGCAGGTGAGCGGG + Exonic
905385147 1:37597804-37597826 GAGATTAAATGCAGCTCTGCTGG + Intergenic
907286824 1:53385828-53385850 TGGAGGAAAGGAAGCTCAGTTGG + Intergenic
909688322 1:78376231-78376253 TGCTTTAAATGCAGTTCAGCAGG - Intronic
911267615 1:95761922-95761944 TGGAGTCAATGCAGATCATTTGG - Intergenic
912006123 1:104903624-104903646 TGGAGTAAATGGAGATCATTTGG - Intergenic
912064728 1:105723009-105723031 TGGGGGAAATGCATTTCAGCAGG - Intergenic
915345268 1:155193885-155193907 TGGAGGAAATGGAGCTAAGCGGG + Intergenic
916599109 1:166275596-166275618 GGTAGTCAATGCAGCTCTGCGGG + Intergenic
916666843 1:166974824-166974846 TGGAATAAAGGAAGCTCAGAGGG - Intronic
916727995 1:167540451-167540473 TGGAGTAAATGCAGCTCAGCAGG - Intronic
919836001 1:201573804-201573826 TGCATTACATTCAGCTCAGCGGG + Intergenic
920328651 1:205187783-205187805 GGAAGGAAATGCAGCTCAGTTGG + Exonic
920400028 1:205670613-205670635 TGAAGAAAAGGCAGCTCAGCAGG - Intronic
920758576 1:208759513-208759535 TGGAGGAATTGCAGCTCTACAGG + Intergenic
1062830499 10:602308-602330 TGCAGCAAATGCAGCTGAGAAGG + Intronic
1067064751 10:43097415-43097437 GAGAGGCAATGCAGCTCAGCTGG - Intronic
1068918509 10:62459383-62459405 AGGAGAAAATGCAGATCATCAGG + Intronic
1074494990 10:113972261-113972283 TGGTGTGAACGCAGCTCACCTGG - Intergenic
1074899221 10:117802230-117802252 AGGAGGAAATGCAGCTCATGTGG + Intergenic
1074978033 10:118596451-118596473 TGGAGTGGAGGCAGCTGAGCCGG + Intergenic
1076767159 10:132642433-132642455 TGGAGAAACTGCAGCTATGCTGG - Intronic
1076913241 10:133402779-133402801 TGCAGTGAATGCAGGGCAGCTGG + Intronic
1076945475 10:133646223-133646245 TTGAGTAACTGCAGCTGGGCTGG + Intergenic
1078084060 11:8223283-8223305 TTGAGTAAATCTAGCTCGGCGGG + Intergenic
1078768051 11:14318658-14318680 TGTAGTCATTCCAGCTCAGCAGG + Intronic
1079936858 11:26627494-26627516 TGAAGAAAATGCAGCTCAGAGGG - Intronic
1080256494 11:30295955-30295977 TGGGGTAAATGCTTATCAGCTGG - Intergenic
1081489893 11:43559036-43559058 TGAAGTAAAACCAGGTCAGCTGG + Intronic
1087781599 11:102306553-102306575 TGGTTTAAATGCATCTCATCAGG - Intergenic
1087821610 11:102718808-102718830 TGGAATAAATGCAGCTTTTCTGG - Intronic
1090993092 11:131838480-131838502 TGCAGAAAATGAAGCTCAGTGGG - Intronic
1093201148 12:16187637-16187659 TGGAGTAAATGGAACACTGCAGG + Intergenic
1099326942 12:81228574-81228596 AGGAGGAAATGCAGGTTAGCAGG + Intronic
1100086736 12:90919998-90920020 TAGAGCAAATGCAGCTAGGCTGG - Intronic
1101657921 12:106740217-106740239 TAGAGAAAATGCAGCTGGGCAGG - Intronic
1101757075 12:107629485-107629507 TGGAGTAAATTCAGGTCCTCTGG - Intronic
1102261771 12:111447418-111447440 CAGAGTGAAAGCAGCTCAGCTGG + Exonic
1102672031 12:114628349-114628371 TGGGGCAAATGGATCTCAGCTGG + Intergenic
1104315252 12:127692926-127692948 TGAAGGAAATGCAGGTCTGCAGG + Intergenic
1104901468 12:132191664-132191686 TGAATTAAATGCAGTTCAGAAGG + Intergenic
1112127292 13:96481997-96482019 TGGAGTTAATGAAGCACAGAAGG - Intronic
1113148707 13:107238427-107238449 TCAGGTAAATGCAGCTCTGCCGG + Intronic
1113774270 13:112933865-112933887 AGGAGGAAAGGCCGCTCAGCTGG + Intronic
1114659976 14:24337907-24337929 AGGAGCTAATGCAGCTCTGCTGG - Exonic
1122147297 14:99699265-99699287 TGGGGAAAATGCAGCACAGAGGG - Intronic
1125511574 15:40295026-40295048 TGGGGTAAATGCGGCTCATCTGG + Exonic
1126645267 15:50869342-50869364 TGGAGTCAATGCAGAACTGCTGG + Intergenic
1127326263 15:57897983-57898005 TGGATTCCATGCAGTTCAGCAGG - Intergenic
1129858684 15:78843477-78843499 TGGAGTAAATGGAGGGGAGCAGG + Intronic
1131998617 15:98157822-98157844 TGGGGAAATTGAAGCTCAGCAGG - Intergenic
1133508705 16:6437253-6437275 TAAAGTAAATGCAGGTCAGTAGG - Intronic
1135993181 16:27229873-27229895 TTCAGTAAATGCAGCTTGGCTGG - Intronic
1136987928 16:35128931-35128953 TGGACTAAATCAAGCTTAGCTGG + Intergenic
1139448484 16:67013331-67013353 TGGAGGAAGTGCAGCTGAGCAGG + Intergenic
1139668345 16:68473866-68473888 TGGAGTCAATGGAGGTCAGCAGG + Intergenic
1141405299 16:83787432-83787454 AGGAGTAAATGGAGCAGAGCGGG - Intronic
1141593883 16:85086036-85086058 TGGAGAAACCGCAGCTGAGCAGG + Intronic
1142175502 16:88643291-88643313 TGCAATAAATGCAGCGAAGCCGG - Exonic
1142749387 17:1978159-1978181 GGGGTTAAATGCAGCCCAGCAGG - Intronic
1144348697 17:14373444-14373466 AGGAGAAAATGCAGCTGGGCTGG - Intergenic
1146276866 17:31521830-31521852 TCAAGTAAAGTCAGCTCAGCAGG + Intronic
1148666732 17:49380546-49380568 CAGTGGAAATGCAGCTCAGCAGG + Intronic
1148961046 17:51393071-51393093 TGGAGTATTTGCGGCTGAGCTGG + Intergenic
1149151438 17:53569048-53569070 TTGAGTAAATGCAGCACACCTGG - Intergenic
1149391782 17:56198731-56198753 GGGAGAAAATACAGATCAGCGGG - Intronic
1151420143 17:73991588-73991610 TGGAGTGACTGCAGCTTTGCAGG + Intergenic
1153362001 18:4207703-4207725 TGGACTAAAAGCAGCTCATGTGG - Intronic
1155548865 18:26943633-26943655 TGGAGAAACTGTAGCTAAGCTGG + Intronic
1156481714 18:37440477-37440499 TGGAGGAAATGCTCCTCAGATGG - Intronic
1158727389 18:59986075-59986097 TTGAGTCAATGAAGCTAAGCTGG + Intergenic
1160464424 18:79064433-79064455 TGGAGTAGATGCAGGCCAGCTGG - Intergenic
1165377041 19:35450089-35450111 TGGAGTGATTGCAGCTCTGGTGG + Exonic
1165435430 19:35792416-35792438 TGGAGTTGTTGCAGCTCTGCCGG - Intergenic
1165914768 19:39251294-39251316 TCCTGGAAATGCAGCTCAGCAGG + Intergenic
926220952 2:10935154-10935176 TGGAGTAAATGAAGCTGAATTGG + Intergenic
927721219 2:25383817-25383839 AGAGGTAAAGGCAGCTCAGCAGG - Exonic
928253947 2:29705890-29705912 GGGAGTATATCCAGCACAGCAGG + Intronic
928722820 2:34140310-34140332 GGGAACAAAAGCAGCTCAGCAGG + Intergenic
929256540 2:39817061-39817083 TGGAGTGTATGCACATCAGCAGG + Intergenic
930154644 2:48093566-48093588 TGGAGTAAATACAGCTTTGCTGG - Intergenic
936156681 2:110051517-110051539 TGGAGGAAGTTCAGCACAGCAGG - Intergenic
936188011 2:110319927-110319949 TGGAGGAAGTTCAGCACAGCAGG + Intergenic
937756831 2:125549719-125549741 TGGAGTCTATGCAGTTCTGCAGG - Intergenic
937866355 2:126754266-126754288 TGGTGCAACTGCAGCTCAGGGGG + Intergenic
945011024 2:205463867-205463889 TGGAGTAAAAGCAGCCGAGTAGG + Intronic
946582258 2:221142366-221142388 TGAAGTAAGATCAGCTCAGCTGG + Intergenic
948643343 2:239388814-239388836 AGAAGTAATGGCAGCTCAGCAGG - Intronic
1169090708 20:2859917-2859939 AGAAGTAAAAGCATCTCAGCAGG - Intronic
1170117445 20:12875643-12875665 TGGAATAAATGCAGCAAAGGAGG - Intergenic
1172278338 20:33693563-33693585 GGGACCAAATGCAGGTCAGCAGG - Intergenic
1173249949 20:41359041-41359063 TGGAGCAGCTGCAGCTTAGCTGG - Exonic
1175472586 20:59241486-59241508 TGTAATAAAAGCAGCTCAACCGG - Intronic
1175972851 20:62695658-62695680 GGGAGTAAATGCTGCCCATCCGG - Intergenic
1177467352 21:21503775-21503797 TAGAGAAAATGCAGCTCAGAGGG + Intronic
1178272859 21:31209179-31209201 TGGAGGAAGTGAAGCTCAGAGGG - Intronic
1180756031 22:18161855-18161877 TGGAGAAGATGCAGGACAGCCGG + Exonic
1180898282 22:19353206-19353228 TGCAGTCAAGGCAGCTCAGCAGG - Intronic
1181075737 22:20375548-20375570 TGGAGAAGATGCAGGACAGCCGG - Exonic
1181103951 22:20560933-20560955 TGAAATAAATGCAAGTCAGCAGG + Intronic
1182293608 22:29300172-29300194 GGTAGTCAATGCAGCTCTGCGGG - Exonic
1184106097 22:42368409-42368431 TGGAGAAACTGCAGCTGAGGCGG - Intergenic
1185038805 22:48493863-48493885 AGGAGTAAATGCGGCTCTCCAGG - Intronic
1185146617 22:49140689-49140711 TGCAGCAAATGCAGCCCGGCTGG + Intergenic
950092793 3:10308272-10308294 TCTAGGAAATGCAGCTGAGCAGG - Intronic
955560936 3:60189984-60190006 TGGCCTAAATGCAGGTCAGATGG - Intronic
955786805 3:62549924-62549946 GGGAGGAAATGTACCTCAGCTGG - Exonic
956339709 3:68208760-68208782 TGGAGGAAATTCTGCACAGCAGG - Intronic
960055170 3:113271920-113271942 TGGATTCCATTCAGCTCAGCCGG + Intronic
960185279 3:114630558-114630580 TGCAGCAAATGCAGCTAACCTGG - Intronic
960829640 3:121833058-121833080 TGGAGAAAATTCACCTCAGAAGG + Intronic
964503523 3:157374073-157374095 TGGAGTAAATGAATAACAGCTGG + Intronic
964644655 3:158946244-158946266 TGGAGTAAATCCAGCATAGAGGG - Intergenic
967092675 3:186148706-186148728 GAGAGTAAATCCAGCCCAGCAGG + Exonic
968849766 4:3071192-3071214 TGGAGTCACAGCAGCTCAGACGG + Intergenic
969122143 4:4918606-4918628 TGCAGAAAAGCCAGCTCAGCCGG + Intergenic
975386327 4:73764176-73764198 GTGAGTAAATGCGGATCAGCTGG + Intergenic
975717265 4:77217070-77217092 AGAGGTAAATACAGCTCAGCTGG + Intronic
980340515 4:131539542-131539564 TTGAAGAAATGCAGCTCTGCTGG - Intergenic
982407731 4:155039308-155039330 TTGAATAAATGCAGCTCAGAAGG - Intergenic
982868919 4:160551052-160551074 TGTAGTAAATGCTTCTCAGAAGG - Intergenic
985697813 5:1351364-1351386 TGGTGTGAATGCACCACAGCTGG + Intergenic
985961825 5:3308359-3308381 TGGTGGAAATGCAGCTCGGCAGG + Intergenic
988104504 5:26726599-26726621 TGCACTGAGTGCAGCTCAGCTGG - Intergenic
988285902 5:29215367-29215389 TGAGGTAAATGCATCTCAGAAGG - Intergenic
996724073 5:126658548-126658570 TGGACGAAATGCAGCTGAACTGG - Intergenic
1003136520 6:3438805-3438827 TGGAATAAACAAAGCTCAGCAGG - Intronic
1003873214 6:10417450-10417472 TGGCATAAATGCAGCTCGGCTGG - Intronic
1004115409 6:12761932-12761954 TGGAAGAAATGCAGGGCAGCTGG - Intronic
1006311015 6:33259818-33259840 TGGAGAAAATGTGGCTCAGTAGG + Intronic
1007251044 6:40495273-40495295 GTGAGAAAATGCAGGTCAGCTGG - Intronic
1012526342 6:100182473-100182495 TGGAGCAAATGCAGCTCAGCTGG + Intergenic
1013668335 6:112371079-112371101 TGGAGTAACTGGTGCTCACCAGG - Intergenic
1017945176 6:159090769-159090791 TGGAGAAACTGCAGCTGAGGCGG - Intergenic
1018567951 6:165177009-165177031 TGGAAAACACGCAGCTCAGCTGG + Intergenic
1020140659 7:5609741-5609763 TGGAGGAAATGGGGCCCAGCTGG - Intergenic
1021862177 7:24916827-24916849 TGGTGTAACAGCAGCACAGCTGG - Intronic
1022018217 7:26372542-26372564 TAAAGTAAATACAGCTCCGCAGG + Exonic
1022943509 7:35260777-35260799 TGCAGAAAATGAAGCTCAGAAGG + Intergenic
1024246297 7:47472752-47472774 TGGAGCAAGTGCAGACCAGCAGG - Intronic
1027266887 7:76499417-76499439 TGGTGTAAAGGGAGTTCAGCAGG + Intronic
1027318703 7:76999277-76999299 TGGTGTAAAGGGAGTTCAGCAGG + Intergenic
1030042189 7:105461513-105461535 AGAAGTAAATGAAGCTAAGCCGG - Intronic
1031470151 7:122159033-122159055 TGGAGCAGATGCAGCTAAGAAGG - Intergenic
1033072329 7:138215444-138215466 TTGAGATAATGCAGCTCACCAGG + Intergenic
1035647892 8:1242527-1242549 TTGAGGAAATGTACCTCAGCAGG - Intergenic
1036870733 8:12433313-12433335 TGGAAAAGATGCAGCACAGCAGG - Intronic
1040530992 8:48266108-48266130 TAGAGTAAAAGCTGCTCAGAAGG - Intergenic
1040899465 8:52403163-52403185 TGGAGTTGCTGCAGCTCAGTTGG + Intronic
1042724998 8:71864426-71864448 TGGAGTAAACACAGTTCAGATGG - Intronic
1043190672 8:77218622-77218644 TGGAGAAACTGCAGGTAAGCTGG + Intergenic
1050938025 9:11423807-11423829 TGGACCACATGCAGCCCAGCAGG - Intergenic
1052233367 9:26182089-26182111 TGAAGAAAAACCAGCTCAGCAGG + Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1060194560 9:121615305-121615327 TGGAGTAAACAAATCTCAGCAGG - Intronic
1060287170 9:122264414-122264436 CAGAGTTATTGCAGCTCAGCTGG - Intronic
1061198541 9:129122428-129122450 GGGTGTAACTGCAGCCCAGCAGG + Intronic
1185735339 X:2491546-2491568 TGCAGTGAATGAAGCTCAGGTGG - Intronic
1186018159 X:5222873-5222895 TGAAGTCCAGGCAGCTCAGCAGG - Intergenic
1188545256 X:31298738-31298760 ATGAGTAAATGCTGCTCAGCAGG + Intronic
1189122794 X:38413076-38413098 TGGAGTAGATGCAGCTGAGTGGG + Intronic
1189350373 X:40271316-40271338 TGAAGAAAATGCAGTTCAGAGGG + Intergenic
1190229901 X:48574232-48574254 AGGGATAAAGGCAGCTCAGCCGG + Intergenic
1192149792 X:68705173-68705195 TGGAGCAACTGCAGCAGAGCAGG + Intronic
1193750921 X:85342596-85342618 TGAAGGTCATGCAGCTCAGCAGG + Intronic
1198673890 X:139111147-139111169 GAGAGTAAATGCATCCCAGCTGG + Intronic
1198687674 X:139244764-139244786 TGGAGGAAGTGCAGCCCTGCTGG + Intergenic
1199598795 X:149528324-149528346 TGGAGTGAAGGCAGATCAGACGG + Intronic
1200960590 Y:8992550-8992572 TGGAGCAAATGGAGGTCAGTAGG - Intergenic